1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
maw [93]
3 years ago
12

This leaf is an example of a plant organ True O False

Biology
2 answers:
Dafna11 [192]3 years ago
7 0

Explanation:

true

..................

kvasek [131]3 years ago
4 0

Answer:

True

Explanation:

Basically, leaf is an organ of plant as it is also a very important part of plant on which the process of photosynthesis took place and also the food is prepared on the surface of leaf and the extra food us stored in the form of glucose. In addition organ is a collection of tissues joined together as a structural unit in order to perform a common function.

Mark As Brainliest :>

You might be interested in
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
How many cells are present after 80mins
frutty [35]

There are about 16 cells present after 80mins.

4 0
3 years ago
Read 2 more answers
Where is a blizzard most likely to form?
Marianna [84]

Answer:

C. Northwestern side of a low-pressure system

Explanation:

I just did the test ^^

4 0
3 years ago
A woman with a long history of rectocele has perineal scarring from multiple episiotomies and has developed a rectovaginal fistu
elena55 [62]

The correct answer is CPT code 57308, 619.1, 624.4. This codes define or describe what the doctor did as a medical procedures and services. For example this CPT 57308 is a code procedural code the range repair of procedures on the vaginal.

4 0
3 years ago
Read 2 more answers
How you can use a magnet to tell the difference between real and fake coins.
hichkok12 [17]

Answer:

First off, grab a simple magnet and hold it near your precious metal coin. If the coin is even slightly attracted to the magnet, then you know you have a fake on your hand, as metals with contents of iron and steel are the most likely to be attracted

8 0
3 years ago
Read 2 more answers
Other questions:
  • The arrows in the chart above represent the movement of carbon between four reservoirs: the ocean, plants, fossil fuels, and the
    9·1 answer
  • The renal corpuscle includes which parts of the nephron?
    9·1 answer
  • What is one observable adaptation of the redbud tree that makes it a member of the legume family?
    11·1 answer
  • What would happend to the producers if a virus broke out among the primary consumer and wiped out mostly of the species
    10·2 answers
  • The level of oxygen in the air is measured in a garden and on a city road. Which location has a higher level of oxygen and why?
    11·1 answer
  • 6. If an atom has 8 protons, 8 neutrons and 8 electrons and then loses an electron, what is it? What is its charge?
    12·1 answer
  • What do you already know about heredity?
    13·2 answers
  • What do these reactions say about substances and chemical reactions?
    8·1 answer
  • (please help ASAP!) Chimpanzees, chickens, cows, and human beings all share a gene for an insulin hormone. What does this sugges
    11·1 answer
  • The difference between plant and animal cells is:
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!