A plant can have green (G) or yellow (g) leaves. It can also have a long (K) or

Biology

1 answer:

oee [108]3 years ago

8 0

The correct answer would be gk and gK.
Gamete refers to the haploid germ cell (male or female) which is able to fuse with another gamete of opposite sex of the same species in order to produce zygote.
According to the law of segregation only one copy of the gene (allele) is distributed to each gamete. In addition, it is a random process.
For example, gene Aa would result in the formation of two types of gametes. One will carry A and the other will carry a.
Now, according to the law of independent assortment, alleles of two or more genes are into the gametes independent of each other.
For example, in AABB alleles of gene AA and alleles of BB will be inherited independent of each other.
Now, gametes produced from gg will of only one type that is, g.
Gametes produced by Kk will be of two types which are K and k.
Lastly, all the alleles will be inherited independent of each other which forms two types of gametes. One bearing gK and one bearing gk.

You might be interested in

Which of the following is a benefit of recreation activities?

9966 [12]

Answer:

C Noise pollution

Explanation:

because organisms create noise.

3 0

3 years ago

Read 2 more answers

Which mRNA sequences would form a structure that is a cue for transcription termination of some genes? 5′−GGCCCUUUUACCCGGUUUU−3′

Blizzard [7]

First, you must know what the stop codons are: UAA, UAG, and UGA

Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed

Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"

4 0

4 years ago

1: _____ chromosomes are found in body cell but not sex cells.

pantera1 [17]

Answer:

1. homologous.

2. Meiosis

3. Human sex cells do have 23 chromosomes, but not these 23. ... None, egg cells don't have chromosomes. No, sex cells do have chromosomes. Meiosis reduces chromosome number so that sex cells (eggs and sperm) have a half set of chromosomes one homolog of each pair. This is the haploid number.

8 0

3 years ago

Read 2 more answers

Infants born to mothers who experienced an unusual amount of stress during pregnancy tend to have

lapo4ka [179]

C-sections instead of natural delivery

8 0

4 years ago

Describe the three major sources of energy taht power earth's environmental systems

MArishka [77]

There are two major sources of energy that power the earth's environmental systems, these are SUN AND THE EARTH'S INTERIOR HEAT.
The heat energy from the sun is the one responsible for processing all the external processes that occur in the atmosphere, hydrosphere and on the earth surface.
The energy from the earth's interior is the one that is respondsible for powering the internal processes that produce earthquakes, volcanoes eruptions and mountain formation.

3 0

3 years ago