1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
LekaFEV [45]
3 years ago
11

Natural resources a. are inputs provided by nature. b. include land, rivers, and mineral deposits. c. take two forms: renewable

and nonrenewable. d. All of the above are correct.
Biology
1 answer:
elena55 [62]3 years ago
8 0

Answer: d. All of the above are correct.

Explanation: Natural resources are resources provided by nature. They occur in nature without manmade interference. Natural resources include mineral deposits, land water bodies and the atmosphere. These resources are utilized by man for economic, social and educational purposes. Natural resources can be renewable or nonrenewable resources such as water are renewed by rainfall. Heavy manmade activities such as industrialization, war or natural disasters can deplete these resources.

You might be interested in
Scientific inquiry what do scientists do answer key
AfilCa [17]
Scientists<span> are people who use research and experiments to learn more about the natural world. </span>Scientists<span> use scientific methods to derive knowledge systematically, performing repeatable experiments to ensure that their conclusions are valid and accurate.</span>
6 0
3 years ago
Darwin was offered a position on the _________________ whose mission was to survey the waters around South America.
malfutka [58]

Darwin was offfered a position as a naturalist on the HMS Beagle, one of the Britsh Royal Navy's survey ship.

4 0
3 years ago
WILL GIVE BRAINLIEST!!!
Rama09 [41]

Answer:

i would like to choose sublimation process to explain about water cycle.As mentioned, sublimation is the process in which snow melts and water get vaporized. Ice melts and turns into water which flows to the seas and oceans.When the temperature increases during the day time, water gets vaporized.Water vapour begin to move upward.As we know, temperature decreases with the increase in height.Due to which water vapour rises,cools and then changes into tiny water molecules.Those water molecules forms cloud.Then the clouds get heavier and begin to collide with each other.As a result rain fall occurs.

Evapotranspiration has also the same process but the difference is that it involves vaporization of water from some biological factor like plants and physical factor like from soil .

i think its my first longest answer which i answered here.Thank you for the amaizing question. Its simple but most important topic

4 0
3 years ago
This pie chart shows several ways that the United States made electricity in 2009. The chart shows that was the main source of e
damaskus [11]
1. Coal.
2. how much carbon dioxide is emitted by each source.
3. how to maximize the use of  clean sources of energy. 
<span />
6 0
3 years ago
Read 2 more answers
_____________________, commonly known as sea squirts, have a larval stage that resembles a chordate.
svetlana [45]

Urochordates, commonly known as sea squirts have a larval stage that resembles a chordate.

What are Urochordates? Give the characteristics of it.

Ascidians (sea squirts) are a common term for the Urochordata, also known as the Tunicata. The body of an adult tunicate is fairly simple. While possessing all the characteristics of a chordate, including a notochord, a dorsal nerve cord, pharyngeal slits, and the larva of many tunicates swims freely and lacks only these characteristics. Ascidia, Salpa, and Doliolum, for instance.

Characteristics features of Urochordata:

1. The grownups are anchored to the foundation.

2. It is also known as "Tunicate" because an adult's body is covered by a tunic formed of tunicin, a cellulose-like substance.

3. The notochord only appears in the larval stage and vanishes in the adult.

4. In adults, a dorsal ganglion takes the role of the nerve cord that is present in the larva.

5. The larva can migrate and changes into a different animal.

Learn more about Urochordata here:

brainly.com/question/1186221

#SPJ4

3 0
2 years ago
Other questions:
  • PLS HELP I WILL GIVE BRAINLEST
    12·2 answers
  • In Earth’s water cycle, evaporation takes place as solid ice and snow are converted to water vapor.
    5·1 answer
  • Your research group is investigating the possible use of genetically - engineered cells to produce a vaccine for malaria. In par
    6·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • What is a fossil record​
    8·2 answers
  • What is species distribution?
    8·2 answers
  • Select the correct answer.
    13·2 answers
  • Match each type of organic compound to its description.
    12·1 answer
  • Water reacts with sodium metal to produce sodium hydroxide and hydrogen
    15·1 answer
  • TRUE/FALSE. if one parent has all blue eyes in the family and the other parent has brown eyes can the baby have green eyes
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!