All categories

3 years ago

In what ways are the features of a plant living in water different from a plant living on land ?

Biology

1 answer:

lesya692 [45]3 years ago

7 0

Answer:

Earth, both on land and in water. Wherever they

live, plants provide food and oxygen to the

creatures that live nearby – including humans!

In this activity we will examine both a

terrestrial (land) plant and an aquatic (water)

plant. They have many things in common, but the

ways they get air, food and water change along

with the environments in which they live.

Explanation:

You might be interested in

Based on your knowledge of the water cycle, from what bodyof water does the most water evaporate? Why?

RUDIKE [14]

Answer: oceans

Explanation: oceans have a greater surface area. over 70% of the Earth’s surface is covered by water.

5 0

2 years ago

Antibodies are composed of two types of peptides, heavy chains and light chains. One of the major classes of antibody molecules

timurjin [86]

Answer and Explanation:

a. form the antigen-binding site ⇒ both chains

The antigen-binding site is formed by one hypervariable region of the light chain (VL) and one hypervariable region of the heavy chain (VH). So, both type of chains contributes to antigen recognition.

b. contain multiple variable domains ⇒ none

Both chains - light and heavy - contain only one variable domain (VL and VH).

c. are found in the Fab fragment ⇒ both chains

The Fab fragment is composed of portions of both light and heavy chains: each portion contains one variable domain and one constant domain. The Fab fragment binds specifically the antigen.

d. are found in the FC fragment ⇒ heavy chains

The Fc region is composed of portions of heavy chains (CH² and CH³), so it contains constant domains.

e. contain only one constant domain ⇒ light chains

Each light chain contains one variable domain (VL) and one constant domain (CL).

f. contain multiple constant domains ⇒ heavy chains

Each heavy chain contains three constant domains: CH¹, CH² and CH³.

g. contain only one variable domain ⇒ both chains

Both light and heavy chains contain one variable domain. The difference is given by the number of constant domains: light chains have 1 constant domain while heavy chains have 3 constant domains.

8 0

3 years ago

A postmortem analysis of einstein's brain revealed a much greater concentration of ________ than found in the average adult brai

balandron [24]

I believe the answer to your question is Glial cells

4 0

3 years ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago

compare the reproductive strategies of a short lived species such as a starfish and a long lived species such as a hippopotamus

AVprozaik [17]

Answer:

Starfish reproduce every winter by ejecting there eggs into the water, since they only live on average 35 years they reproduce about 35 times in their lifetime. Only a couple of the eggs will fertilize and turn into a Starfish.

Hippos are the only mammals in Africa that reproduce in water, Hippos reproduce in May and through June. Hippos usually live to around 40 to 50 years, and most hippos through May and June reproduce more than one time.

Explanation:

Hippos strategies of reproducing are better than Starfish.

8 0

3 years ago