1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
eduard
3 years ago
9

PLEASE HELP ASAP!!

Biology
2 answers:
il63 [147K]3 years ago
6 0

Answer:

Natural or human-induced factors that directly or indirectly cause a change in biodiversity are referred to as drivers. Direct drivers that explicitly influence ecosystem processes. include land use change, climate change, invasive species, overexploitation, and pollution.

Nutka1998 [239]3 years ago
3 0
The correct answer is B
You might be interested in
What are ribosomes in like real life?
ikadub [295]
The best example i can come up is a car factory. Car instructions go in (mRNA), car parts put together (amino acid chain), and then completed cars leave (protein).
6 0
2 years ago
Which of the following is least likely to increase the rate of diffusion
IrinaK [193]
The one that is least likely to increase the rate of diffusion would be : small concentration of gradient

The rate of diffusion will more likely to increase if : 
- the concentration gradient is greater
- distance is decreased
- The surface Area is increased

hope this helps
3 0
2 years ago
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
2 years ago
If you move a substance from one container to another and its volume changes oh, the substance is a? a) solid b) liquid c) gas d
rosijanka [135]

Answer:

d

Explanation:

With gases they escape into the atmosphere so u cant move it around withoulosing some. With liquids sometimes they get spilled or little bit gets left at the bottom of the original container

7 0
3 years ago
Read 2 more answers
Pls help question is in picture
iris [78.8K]

Answer:

im pretty sure its d

Explanation:

jsbsjhs

4 0
3 years ago
Other questions:
  • Based on Miller's experiments, chemical evolution theory proposes what was the first genetic material?
    8·1 answer
  • Please help! WILL GIVE BRAINLIEST
    15·2 answers
  • Which feature is an example of behavioral adaptation? A. turtles’ shells B. nocturnal nature in rodents C. cacti’s ability to st
    10·2 answers
  • Alexis weighs 6.5 pounds at birth. Assuming her development proceeds normally, she should weigh about _____ pounds by her first
    15·1 answer
  • Which of the following best describes all pioneer species?
    8·1 answer
  • During the growth stage, plants ____.
    9·2 answers
  • I really need help please! Thank you
    13·1 answer
  • If mitosis happens in our gonad cells that produce egg or sperm. How will it impact the progeny's chromosome number? Emphasize a
    10·1 answer
  • how can you explain what you know about the heavily muscled cows with what you have learned about mutations, patterns of inherit
    15·1 answer
  • The ________is able to adjust the body temperature by either increasing or decreasing heat production during th
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!