Answer:
TACTTCGAGAAAACCAACGAAAAGTGGTAA
Explanation:
Transcription is the process by which a strand of DNA is copied into mRNA.
Remember that in mRNA, U (Uracil) bonds with A (Adenine).
Hope that helps.
The correct answer is:
A. A group of related parts that work together to achieve a desired result.
I hope this answer was helpful!
The correct answer is C. learning about the interactions and functions of living organisms
It also studies creature of the air and does not necessarily focus only on human problems. It also deals with dead creatures, not only living ones.
Answer:
Rays of sun light- From DJ a.ka Me!
Explanation:
Process of producing cellular energy involving oxygen