1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
cricket20 [7]
3 years ago
10

5. In a food web, what is the role of detritivores and decomposers and at what level do

Biology
1 answer:
Ray Of Light [21]3 years ago
5 0

Answer:

Detritivores (also known as detrivores, detritophages, detritus feeders, or detritus eaters) are heterotrophs that obtain nutrients by consuming detritus (decomposing plant and animal parts as well as faeces). There are many kinds of invertebrates, vertebrates and plants that carry out coprophagy. By doing so, all these detritivores contribute to decomposition and the nutrient cycles. They should be distinguished from other decomposers, such as many species of bacteria, fungi and protists, which are unable to ingest discrete lumps of matter, but instead live by absorbing and metabolizing on a molecular scale (saprotrophic nutrition). However, the terms detritivore and decomposer are often used interchangeably but they are different organisms. Detritivore are usually arthropods and help in the process of remineralization. Detritivores perform the first stage of remineralization, by fragmenting the dead plant matter. Allowing for decomposers to perform the second stage of remineralization.

Decomposers are organisms that break down dead or decaying organisms; they carry out decomposition, a process possible by only certain kingdoms, such as fungi. Like herbivores and predators, decomposers are heterotrophic, meaning that they use organic substrates to get their energy, carbon and nutrients for growth and development. While the terms decomposer and detritivore are often interchangeably used, detritivores ingest and digest dead matter internally, while decomposers directly absorb nutrients through external chemical and biological processes. Thus, invertebrates such as earthworms, woodlice, and sea cucumbers are technically detritivores, not decomposers, since they must ingest nutrients - they are unable to absorb them externally.

Explanation:

You might be interested in
Match the vitamin deficiencies and their symptoms.
Kryger [21]

Answer:

depression: B6

dry skin and nails: A

excessive bleeding: K

6 0
3 years ago
9 and 10! Brainliest involved
mariarad [96]

Answer:

9 is true

10 is d

Explanation:

make me brillent plz

5 0
3 years ago
PLEASE HELP!!!
aalyn [17]

Answer:

option C is the correct option

5 0
4 years ago
Dr. Bartholomew believes people who are very hostile have become so because of their environment. Dr. Tiburon believes people's
bagirrra123 [75]

Answer:

Nature and Nurture

Explanation:

Dr Bartholomew believes that behaviour  is because of nurture, meaning that it is based on where you are raised or who raised you.

Dr. Tiburon on te other hand believe that behaiour is something that you inherit from birth and therefore believes in nature.

7 0
4 years ago
Read 2 more answers
A person has a bone fracture and takes a painkiller that causes blood-vessel constriction. Why might this painkiller actually sl
Elan Coil [88]
In contrast to compact bone, spongy bones does not contain true Haversian systems( tiny tubes that form a network in bone and contain blood vessels) but consist of an irregular lattice of thin plates of bone called trabeculae.The spaces between trabeculae are filled with marrow. The cells of the red marrow are responsible for producing blood. Within trabeculae  lie lacunae which contain osteocytes.<span> Blood vessels from the periosteum penetrate through to the spongy bone,  and osteocytes in the trabeculae are nourished directly from the blood circulating through the marrow cavities.</span>
6 0
3 years ago
Other questions:
  • What is activation energy?
    7·2 answers
  • What are the strengths and limitations of this model ?
    15·2 answers
  • How can a decrease in blood pressure affect blood flow?
    15·1 answer
  • Given the formula D=M/V, a substance with a Density of 50 gm/cc, with a Volume of 10 cc, has a Mass of
    13·2 answers
  • The wht circulation of the circulatory system brings carbon dioxide filled blood to the lungs
    14·2 answers
  • What is the advantage of having the bacterial dna near the center of the cell?
    5·2 answers
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • List two ways the sun affects weather and climate. Explain each
    14·1 answer
  • The breathing rate , heart rate , and blood hormone levels of an individual would directly provide information about that indivi
    15·1 answer
  • what do you call animals that live on land? A.animals on land. B.Aqua animals. C.Soil animals D.Terrestrial animals​
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!