1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Viktor [21]
2 years ago
8

Choose the correct connective tissue.

Biology
2 answers:
PSYCHO15rus [73]2 years ago
6 0

Explanation:

A tendon is a fibrous connective tissue which attaches muscle to bone. Tendons may also attach muscles to structures such as the eyeball. A tendon serves to move the bone or structure. A ligament is a fibrous connective tissue which attaches bone to bone, and usually serves to hold structures together and keep them stable.

vaieri [72.5K]2 years ago
3 0

Answer:

1)Bone to Bone-<u>Ligament</u>

2)Muscle to Muscle-<u>Tendon </u>

Explanation:

Please mark me as brainliest

You might be interested in
If a cell of an organism contains a nucleus, the organism is a
asambeis [7]
<span>Eukaryota i think this is the right answer
 </span><span />
5 0
3 years ago
Read 2 more answers
Case 12-2 Mother Goose Computing, Inc. provides computational biology consulting services. They are currently updating several o
Reil [10]

Answer:

Direct.

Explanation:

An information system can be defined as a set of components or computer systems, which is used to collect, store, and process data, as well as dissemination of information, knowledge, and distribution of digital products.

Generally, it is an integral part of human life because individuals, organizations, and institutions rely on information systems in order to perform their duties, functions or tasks and to manage their operations effectively. For example, all organizations make use of information systems for supply chain management, process financial accounts, manage their workforce, and as a marketing channels to reach their customers or potential customers.

Additionally, an information system comprises of five (5) main components;

1. Hardware.

2. Software.

3. Database.

4. Human resources.

5. Telecommunications.

Hence, an information system interacts with the overall system by receiving data in its raw forms and information in a usable format.

In this scenario, Mother Goose Computing, Inc. are currently updating several of their systems. For the genomics division, it's planning to replace the old system by the new one all at once. Thus, this is called a direct conversion.

Direct conversion can be defined as a process which typically involves the establishment and implementation of a new system followed by an immediate discontinuation of the old system all at once. Thus, on a particular date and time, the old system would be discontinued while the new system is immediately adopted for use in the particular organization.

8 0
2 years ago
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
2 years ago
Two males weigh 195 pounds and are 45 years old. one has a body fat percentage of 13% and the other's body fat percentage is 29%
Komok [63]
The burn of calories is connected to gender, mass and the age. These characteristics are the similar for both individuals, so you have to look for the outcome of the body fat percentage.


Muscles are an active tissue which suggests that at rest they burn calories in a bigger proportion than fat. So, the male with more muscles will likely burn more calories at rest.


The lower the fat percentage the higher the muscle percentage.



To conclude, that the male with 13% of body fat will burn more calories at rest than the male with 29% of body fat.
6 0
3 years ago
What incentives does the government offer to
zlopas [31]

The incentive the government offer to business who lower their carbon emission and use alternative energies include:

  • Renewable Electricity Production Tax Credit (PTC)
  • Investment Tax Credit (ITC).

<h3>What is Carbon emission?</h3>

This refers to the amount of carbon dioxide when fossil fuel such as coal, crude oil is burnt for different types of reasons.

This is required to be reduced as it is responsible for pollution and global warming being experienced in different parts of the world.

There are several types of incentives offered to businesses in other to encourage them to lower their carbon emission and adopt the use of alternative sources of energy and an example is Investment Tax Credit.

Read more about Carbon emission here brainly.com/question/22916556

#SPJ1

8 0
1 year ago
Other questions:
  • What are the basic needs of a cell?
    14·1 answer
  • What's the job of the iris
    13·1 answer
  • Which scenario describes a way that an abiotic factor can impact a marine system? Liquid water turning into solid ice encourages
    11·1 answer
  • In the equation below, identify which side has more entropy and why.<br><br> CaCO3→CaO+CO2
    8·1 answer
  • Click to review the online content. Then answer the question(s) below, using complete sentences. Scroll down to view additia
    5·2 answers
  • If a tRNA molecule has an anticodon which reads AUG, what was the codon of the mRNA molecule?
    7·1 answer
  • Why is complementary base pairing so important to the success of protein synthesis?
    15·1 answer
  • I need help please
    7·2 answers
  • Why the loss of biodiversity is a terrible global calamity?
    7·1 answer
  • The kidney is a(n)______<br> The excretory system is a(n)_____
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!