1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
egoroff_w [7]
3 years ago
14

HELP PLEASE WILL GIVE BRAINLY! What is a complementary RNA strand to AGA?

Biology
1 answer:
Irina18 [472]3 years ago
5 0

Answer:Problem Set 4 Answers

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d. The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

2. Below is a table for the genetic code:

T

C

A

G

T

TTT Phe (F)

TTC "

TTA Leu (L)

TTG "

TCT Ser (S)

TCC "

TCA "

TCG "

TAT Tyr (Y)

TAC "

TAA Stop

TAG Stop

TGT Cys (C)

TGC "

TGA Stop

TGG Trp (W)

C

CTT Leu (L)

CTC "

CTA "

CTG "

CCT Pro (P)

CCC "

CCA "

CCG "

CAT His (H)

CAC "

CAA Gln (Q)

CAG "

CGT Arg (R)

CGC "

CGA "

CGG "

A

ATT Ile (I)

ATC "

ATA "

ATG Met (M)

ACT Thr (T)

ACC "

ACA "

ACG "

AAT Asn (N)

AAC "

AAA Lys (K)

AAG "

AGT Ser (S)

AGC "

AGA Arg (R)

AGG "

G

GTT Val (V)

GTC "

GTA "

GTG "

GCT Ala (A)

GCC "

GCA "

GCG "

GAT Asp (D)

GAC "

GAA Glu (E)

GAG "

GGT Gly (G)

GGC "

GGA "

GGG "

a. The following codons can be mutated by one base to produce an amber codon:

CAG    Gln

AAG    Lys

GAG    Glu

TCG    Ser

TTG    Leu

TGG    Trp

TAA    Stop

TAT    Tyr

TAC    Tyr

b. From part a, CAG (Gln) and TGG (Trp) can become amber stop codons through EMS.

c. From part b, both of the resulting amber codons could be suppressed by amber nonsense suppressors generated by EMS.

3a. The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain.  The anticodon is the complementary three nucleotide sequence in the appropriate tRNA.

b. Template strand is the DNA strand off which the mRNA is synthesized.  The coding, or non-template, strand is the DNA strand complementary to the template strand; it has the same sequence (except for T for U substitutions) as the mRNA.

c. The Pribnow box is a sequence of six nucleotides (TATAAT) positioned at -10 that signals where transcription initiation should begin in prokaryotic DNA.  The Shine-Delgarno sequence is a short, purine-rich region in the mRNA that is complementary to the rRNA within the 16S ribosomal subunit.  The sequence signals which AUG acts as the translation start in mRNA.

4a. False, a wobble allows the anticodon in the tRNA to hybridize with different codons in mRNA.

b. False, a frameshift mutation affects all the subsequent amino acids.

c. False, only one codon (AUG) encodes for the start of protein synthesis; three codons signal the end of protein synthesis.

d. False, the wobble is first base (5’ to 3’) in the anticodon.

e. True, RNA can be used as a template for DNA synthesis in a process known as reverse transcription.

f. True.  For example, a single base substitution causing CAT to change to AAT would signal a termination.

g. False, the Wobble Hypothesis explains how alternate base pairing can occur with the first nucleotide (going from 5' to 3') in the anticodon.

5a. Digestion of RNA with alkali will cleave the strand after each 3’ phosphate.  Therefore, the products remaining will consist of pppNp, Np, and N-OH

b. If RNA was synthesized in the 3’ to 5’ direction (i.e. by adding ribonucleotides to the 5’ end), then the pppNp and Np fragments should be labeled with tritium.

c. If RNA was synthesized in the 5’ to 3’ direction (i.e. by adding ribonucleotides to the 3’ end), then the Np and N-OH fragments should be labeled with tritium.

d. Since the N-OH fragments were labeled with tritium, RNA synthesis must occur in a 5' to 3' direction.

6. In a missense mutation, the new nucleotide alters the codon so as to produce an altered amino acid in the protein product.  With a nonsense mutation, the new nucleotide changes a codon that specified an amino acid to one of the stop codons (TAA, TAG, or TGA). Therefore, translation of the messenger RNA transcribed from this mutant gene will stop prematurely.

Explanation:

You might be interested in
What does the nosepiece of the microscope cantain
Rus_ich [418]
"The rotating part of the microscope at the bottom of the body tube; it holds the objectives." -utahscience.oremjr.alpine.k12.ut.us
8 0
3 years ago
Your friend (an endotherm) adopts a 50 kg snake (an ectotherm) as a pet. Your friend also weighs 50 kg. a) Given what you have l
lesantik [10]

Answer:

Friend (endotherm) will need to eat more calories than snake (ectoderm) to maintain constant body temperature.

To generate heat endotherms convert the food they eat into energy through the process called metabolism. Most of the food that the endotherms eat is converted into fuel to maintain a constant body temperature. Endotherms need to eat more food than ectoderms of the same size to maintain their constant body temperature.

Explanation:

3 0
3 years ago
Photosynthesis provide food and oxygen to all the living organism Is this true or False ???​
Arisa [49]

Answer:

True

I hope this helps!

3 0
3 years ago
Read 2 more answers
Dumping of organic wastes into a lake may result in anaerobic conditions in the lake because
adoni [48]
I believe the answer is C
8 0
4 years ago
As Virginia becomes more more populated construction of new homes has destroyed much of a force this has cause rivers and stream
AleksandrR [38]

Answer:

The correct answer is - water pollution.

Explanation:

In the US, water pollution is one of the most serious ecological problems, and sedimentation by filled with dirt, slit caused by development sites or construction sites. It is caused in the name of developing cities and states for new homes and other construction that is nothing but careless development that is causing water pollution in these areas including the Virginia.

The excessive silt has covered the spawning beds of fish causes spawning of the habitat. The dirt and slit and sediments cause inhibiting light to aquatic plants that result in less oxygen and food for aqautic life.

4 0
3 years ago
Other questions:
  • If I turn my computer off at least once a week, it will run faster. What is the independent variable? What is the dependent vari
    12·1 answer
  • Innate immune response to viral and bacterial infections are different. One similarity is that pathogen derived antigens are pre
    15·1 answer
  • 9. in your own words compare and contrast cell division in prokaryotes and eukaryotes
    12·1 answer
  • Which genetic technology is shown in the diagram?
    7·2 answers
  • Why is natural selection important?
    13·2 answers
  • What is CRISPR used for?
    6·1 answer
  • Darwin’s finches evolved on an island. What is the main reason that islands often provide good examples of evolution?
    5·2 answers
  • The behavior that occurs when a wave travels straight through a medium is known as
    6·2 answers
  • "An organism is hungry, so it eats some food".<br>What is the stimulus and the response?​
    10·1 answer
  • How does an autoimmune disease affect the muscular system?
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!