1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
egoroff_w [7]
3 years ago
14

HELP PLEASE WILL GIVE BRAINLY! What is a complementary RNA strand to AGA?

Biology
1 answer:
Irina18 [472]3 years ago
5 0

Answer:Problem Set 4 Answers

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d. The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

2. Below is a table for the genetic code:

T

C

A

G

T

TTT Phe (F)

TTC "

TTA Leu (L)

TTG "

TCT Ser (S)

TCC "

TCA "

TCG "

TAT Tyr (Y)

TAC "

TAA Stop

TAG Stop

TGT Cys (C)

TGC "

TGA Stop

TGG Trp (W)

C

CTT Leu (L)

CTC "

CTA "

CTG "

CCT Pro (P)

CCC "

CCA "

CCG "

CAT His (H)

CAC "

CAA Gln (Q)

CAG "

CGT Arg (R)

CGC "

CGA "

CGG "

A

ATT Ile (I)

ATC "

ATA "

ATG Met (M)

ACT Thr (T)

ACC "

ACA "

ACG "

AAT Asn (N)

AAC "

AAA Lys (K)

AAG "

AGT Ser (S)

AGC "

AGA Arg (R)

AGG "

G

GTT Val (V)

GTC "

GTA "

GTG "

GCT Ala (A)

GCC "

GCA "

GCG "

GAT Asp (D)

GAC "

GAA Glu (E)

GAG "

GGT Gly (G)

GGC "

GGA "

GGG "

a. The following codons can be mutated by one base to produce an amber codon:

CAG    Gln

AAG    Lys

GAG    Glu

TCG    Ser

TTG    Leu

TGG    Trp

TAA    Stop

TAT    Tyr

TAC    Tyr

b. From part a, CAG (Gln) and TGG (Trp) can become amber stop codons through EMS.

c. From part b, both of the resulting amber codons could be suppressed by amber nonsense suppressors generated by EMS.

3a. The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain.  The anticodon is the complementary three nucleotide sequence in the appropriate tRNA.

b. Template strand is the DNA strand off which the mRNA is synthesized.  The coding, or non-template, strand is the DNA strand complementary to the template strand; it has the same sequence (except for T for U substitutions) as the mRNA.

c. The Pribnow box is a sequence of six nucleotides (TATAAT) positioned at -10 that signals where transcription initiation should begin in prokaryotic DNA.  The Shine-Delgarno sequence is a short, purine-rich region in the mRNA that is complementary to the rRNA within the 16S ribosomal subunit.  The sequence signals which AUG acts as the translation start in mRNA.

4a. False, a wobble allows the anticodon in the tRNA to hybridize with different codons in mRNA.

b. False, a frameshift mutation affects all the subsequent amino acids.

c. False, only one codon (AUG) encodes for the start of protein synthesis; three codons signal the end of protein synthesis.

d. False, the wobble is first base (5’ to 3’) in the anticodon.

e. True, RNA can be used as a template for DNA synthesis in a process known as reverse transcription.

f. True.  For example, a single base substitution causing CAT to change to AAT would signal a termination.

g. False, the Wobble Hypothesis explains how alternate base pairing can occur with the first nucleotide (going from 5' to 3') in the anticodon.

5a. Digestion of RNA with alkali will cleave the strand after each 3’ phosphate.  Therefore, the products remaining will consist of pppNp, Np, and N-OH

b. If RNA was synthesized in the 3’ to 5’ direction (i.e. by adding ribonucleotides to the 5’ end), then the pppNp and Np fragments should be labeled with tritium.

c. If RNA was synthesized in the 5’ to 3’ direction (i.e. by adding ribonucleotides to the 3’ end), then the Np and N-OH fragments should be labeled with tritium.

d. Since the N-OH fragments were labeled with tritium, RNA synthesis must occur in a 5' to 3' direction.

6. In a missense mutation, the new nucleotide alters the codon so as to produce an altered amino acid in the protein product.  With a nonsense mutation, the new nucleotide changes a codon that specified an amino acid to one of the stop codons (TAA, TAG, or TGA). Therefore, translation of the messenger RNA transcribed from this mutant gene will stop prematurely.

Explanation:

You might be interested in
The "photo-" part of the word photosynthesis refers to the _____, whereas "-synthesis" refers to ____
Debora [2.8K]

Answer:

1. Light

2. production of large component from smaller components

Explanation:

In the given question, the meaning of the word Photo is light and the synthesis refers to the production and combining these words form photosynthesis. The literal meaning of photosynthesis will be the production of some compounds in the presence of light.

The word photosynthesis is used by the biologists to refer to a process taking place in the green plants which involve the light for the synthesis of energy-providing molecule glucose.

Thus, 1. The light and production of the large components are correct.

5 0
3 years ago
Why are biologists still debating the classification of protozoans
e-lub [12.9K]

The biologists have categorized protozoans as a part of Kingdom Protista, they have attempted to sort protists in comparison to three of the other kingdoms, that is, animals, plants, and fungi. However, this has not worked as several of the protists demonstrate features from two or more of these kingdoms.  

The protozoans show considerable diversity, that is, some live as predators, some as parasites, and some others are thriving as producers. Scientists have attempted to categorize the organisms within the protists as either fungus-like, plant-like, or animal-like.  

However, close testing and genetic examination have shown that these classifications often does not imply.  


5 0
3 years ago
Which formed element can be described as membrane-enclosed cytoplasmic fragments?a. monocytesb. erythrocytesc. lymphocytesd. pla
Jlenok [28]

Answer:

d. platelets

Explanation:

Platelets often referred to as thrombocytes, are membrane-bounded cell fragments that are obtained from the dissociation of bigger precursor cells referred to as megakaryocytes, that are produced from stem cells in the bone marrow.

Platelets are necessary for the blood clotting activities, making it very important for wound healing.

7 0
3 years ago
The accidental introduction of invasive species of plants and animals often
RSB [31]

Answer: N. pubens has found a place within the existing food web in its new environment.

Explanation:

The statement that best explains the impact that N. pubens has on its environment is that "N. pubens has found a place within the existing food web in its new environment".

From the information given, it's stated that the Rasberry crazy ant (Nylanderia pubens) was accidentally introduced in Texas and it attacks livestock, displace existing species, and damage electrical equipment.

It's further stated that it consumes "honeydew," a sugary liquid substance secreted as a waste product by aphids, which suck the sap out of plants.

This shows that it has found a place within the existing food web in its new environment.

8 0
3 years ago
.   The combination of sulfur dioxide, nitrogen oxide, and atmospheric moisture creates 
Aleks04 [339]
The combination of sulfur dioxide, nitrogen oxide, and atmospheric moisture creates acid rain.
6 0
3 years ago
Other questions:
  • Patricia needs to put a dressing on an open wound. this procedure requires her to prepare a sterile tray and put on sterile glov
    8·1 answer
  • Simplify the expression 2(3) +26–3).
    5·2 answers
  • What can dried blood tell an expert?
    9·2 answers
  • What would happen to individual muscles if muscle cells failed to function properly?
    6·1 answer
  • Describe the function of the structure pictured below.
    15·1 answer
  • The ________ extends through the hindbrain, midbrain, and forebrain.
    11·1 answer
  • What is the moons orbit?​
    14·1 answer
  • HELP ME!!!!!!PLEASE
    7·1 answer
  • Describe the meaning of parsimony and give an example.
    15·1 answer
  • Part B: Determine Trait Variation in the Species
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!