1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
egoroff_w [7]
3 years ago
14

HELP PLEASE WILL GIVE BRAINLY! What is a complementary RNA strand to AGA?

Biology
1 answer:
Irina18 [472]3 years ago
5 0

Answer:Problem Set 4 Answers

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d. The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

2. Below is a table for the genetic code:

T

C

A

G

T

TTT Phe (F)

TTC "

TTA Leu (L)

TTG "

TCT Ser (S)

TCC "

TCA "

TCG "

TAT Tyr (Y)

TAC "

TAA Stop

TAG Stop

TGT Cys (C)

TGC "

TGA Stop

TGG Trp (W)

C

CTT Leu (L)

CTC "

CTA "

CTG "

CCT Pro (P)

CCC "

CCA "

CCG "

CAT His (H)

CAC "

CAA Gln (Q)

CAG "

CGT Arg (R)

CGC "

CGA "

CGG "

A

ATT Ile (I)

ATC "

ATA "

ATG Met (M)

ACT Thr (T)

ACC "

ACA "

ACG "

AAT Asn (N)

AAC "

AAA Lys (K)

AAG "

AGT Ser (S)

AGC "

AGA Arg (R)

AGG "

G

GTT Val (V)

GTC "

GTA "

GTG "

GCT Ala (A)

GCC "

GCA "

GCG "

GAT Asp (D)

GAC "

GAA Glu (E)

GAG "

GGT Gly (G)

GGC "

GGA "

GGG "

a. The following codons can be mutated by one base to produce an amber codon:

CAG    Gln

AAG    Lys

GAG    Glu

TCG    Ser

TTG    Leu

TGG    Trp

TAA    Stop

TAT    Tyr

TAC    Tyr

b. From part a, CAG (Gln) and TGG (Trp) can become amber stop codons through EMS.

c. From part b, both of the resulting amber codons could be suppressed by amber nonsense suppressors generated by EMS.

3a. The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain.  The anticodon is the complementary three nucleotide sequence in the appropriate tRNA.

b. Template strand is the DNA strand off which the mRNA is synthesized.  The coding, or non-template, strand is the DNA strand complementary to the template strand; it has the same sequence (except for T for U substitutions) as the mRNA.

c. The Pribnow box is a sequence of six nucleotides (TATAAT) positioned at -10 that signals where transcription initiation should begin in prokaryotic DNA.  The Shine-Delgarno sequence is a short, purine-rich region in the mRNA that is complementary to the rRNA within the 16S ribosomal subunit.  The sequence signals which AUG acts as the translation start in mRNA.

4a. False, a wobble allows the anticodon in the tRNA to hybridize with different codons in mRNA.

b. False, a frameshift mutation affects all the subsequent amino acids.

c. False, only one codon (AUG) encodes for the start of protein synthesis; three codons signal the end of protein synthesis.

d. False, the wobble is first base (5’ to 3’) in the anticodon.

e. True, RNA can be used as a template for DNA synthesis in a process known as reverse transcription.

f. True.  For example, a single base substitution causing CAT to change to AAT would signal a termination.

g. False, the Wobble Hypothesis explains how alternate base pairing can occur with the first nucleotide (going from 5' to 3') in the anticodon.

5a. Digestion of RNA with alkali will cleave the strand after each 3’ phosphate.  Therefore, the products remaining will consist of pppNp, Np, and N-OH

b. If RNA was synthesized in the 3’ to 5’ direction (i.e. by adding ribonucleotides to the 5’ end), then the pppNp and Np fragments should be labeled with tritium.

c. If RNA was synthesized in the 5’ to 3’ direction (i.e. by adding ribonucleotides to the 3’ end), then the Np and N-OH fragments should be labeled with tritium.

d. Since the N-OH fragments were labeled with tritium, RNA synthesis must occur in a 5' to 3' direction.

6. In a missense mutation, the new nucleotide alters the codon so as to produce an altered amino acid in the protein product.  With a nonsense mutation, the new nucleotide changes a codon that specified an amino acid to one of the stop codons (TAA, TAG, or TGA). Therefore, translation of the messenger RNA transcribed from this mutant gene will stop prematurely.

Explanation:

You might be interested in
A 24-year-old client is being seen in the emergency department because of a high fever and cannot move the right arm. during the
Flauer [41]
 The client may be suffering from a neuroleptic malignant syndrome (NMS) which is a reaction to his antipsychotic medication. NMS is rare but
life-threatening and is characterized by high fever, muscular rigidity(that's why he can't move his arm), altered mental status hyperthermia, and autonomic dysfunction.

Since is life-threatening, it requires immediate treatment.




8 0
3 years ago
Read 2 more answers
The Celsius temperature scale is also something called the centigrade scale. Why is this?
valentinak56 [21]
There are three temperature scales in use today, Fahrenheit, Celsius and Kelvin.

Fahrenheit temperature scale is a scale based on 32 for the freezing point of water and 212 for the boiling point of water, the interval between the two being divided into 180 parts. The 18th-century German physicist Daniel Gabriel Fahrenheit originally took as the zero of his scale the temperature of an equal ice-salt mixture and selected the values of 30 and 90 for the freezing point of water and normal body temperature, respectively; these later were revised to 32 and 96, but the final scale required an adjustment to 98.6 for the latter value.

Until the 1970s the Fahrenheit temperature scale was in general common use in English-speaking countries; the Celsius, or centigrade, scale was employed in most other countries and for scientific purposes worldwide. Since that time, however, most English-speaking countries have officially adopted the Celsius scale. The conversion formula for a temperature that is expressed on the Celsius (C) scale to its Fahrenheit (F) representation is: F = 9/5C + 32.


Hope this helps.

4 0
3 years ago
Which protein serves as a chemical messenger? hemoglobin actin myosin insulin
kompoz [17]
Insulin is the correct answer.
Hope ti helped!
4 0
3 years ago
Rats can be a real danger when they find<br>their way into your food storage spaces? yes or no​
eduard

Answer:

yes, it could be something that's old or something rats cant eat/drink

Explanation:

5 0
3 years ago
Which school of psychology would agree with the statement that "psychology should stress the study of how behavior and mental pr
Alex17521 [72]

Answer:

Functionalism.

Explanation:

Functionalism is a type of theory or a type of school of psychology that mainly focus on human consciousness and there way of adaptation. This method is relevant for the consciousness study.

Functionalism agrees that the psychology focus on the study of mental and behavior process. This functionalism helps the organism to adapt better to their environment.

Thus, the answer is functionalism.

7 0
3 years ago
Other questions:
  • Which of these is an example of potential energy?
    11·2 answers
  • What is a possible explanation for why bacteria lack ether-linked cell membranes
    12·1 answer
  • Rachel Carson’s warning in Silent Spring was focused on _______.
    12·2 answers
  • 1. Predict Two photographers take time-lapse
    14·1 answer
  • Rough-skinned newts and common garter snakes are in an "evolutionary arms race." In this phenomenon, two species continually evo
    6·2 answers
  • Someone please help with this biology question!!
    6·1 answer
  • Hey guys i need some good facts about mars and pluto and fast will give brailiest and five stars
    11·1 answer
  • The Brahman cattle have good resistance to high temperature, but its meat is poor and tough to eat. The English shorthorn cattle
    11·1 answer
  • How is morphology different from embryology? How is it similar?
    12·1 answer
  • An example of a trait that is determined by multiple alleles is.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!