1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
egoroff_w [7]
2 years ago
14

HELP PLEASE WILL GIVE BRAINLY! What is a complementary RNA strand to AGA?

Biology
1 answer:
Irina18 [472]2 years ago
5 0

Answer:Problem Set 4 Answers

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d. The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

2. Below is a table for the genetic code:

T

C

A

G

T

TTT Phe (F)

TTC "

TTA Leu (L)

TTG "

TCT Ser (S)

TCC "

TCA "

TCG "

TAT Tyr (Y)

TAC "

TAA Stop

TAG Stop

TGT Cys (C)

TGC "

TGA Stop

TGG Trp (W)

C

CTT Leu (L)

CTC "

CTA "

CTG "

CCT Pro (P)

CCC "

CCA "

CCG "

CAT His (H)

CAC "

CAA Gln (Q)

CAG "

CGT Arg (R)

CGC "

CGA "

CGG "

A

ATT Ile (I)

ATC "

ATA "

ATG Met (M)

ACT Thr (T)

ACC "

ACA "

ACG "

AAT Asn (N)

AAC "

AAA Lys (K)

AAG "

AGT Ser (S)

AGC "

AGA Arg (R)

AGG "

G

GTT Val (V)

GTC "

GTA "

GTG "

GCT Ala (A)

GCC "

GCA "

GCG "

GAT Asp (D)

GAC "

GAA Glu (E)

GAG "

GGT Gly (G)

GGC "

GGA "

GGG "

a. The following codons can be mutated by one base to produce an amber codon:

CAG    Gln

AAG    Lys

GAG    Glu

TCG    Ser

TTG    Leu

TGG    Trp

TAA    Stop

TAT    Tyr

TAC    Tyr

b. From part a, CAG (Gln) and TGG (Trp) can become amber stop codons through EMS.

c. From part b, both of the resulting amber codons could be suppressed by amber nonsense suppressors generated by EMS.

3a. The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain.  The anticodon is the complementary three nucleotide sequence in the appropriate tRNA.

b. Template strand is the DNA strand off which the mRNA is synthesized.  The coding, or non-template, strand is the DNA strand complementary to the template strand; it has the same sequence (except for T for U substitutions) as the mRNA.

c. The Pribnow box is a sequence of six nucleotides (TATAAT) positioned at -10 that signals where transcription initiation should begin in prokaryotic DNA.  The Shine-Delgarno sequence is a short, purine-rich region in the mRNA that is complementary to the rRNA within the 16S ribosomal subunit.  The sequence signals which AUG acts as the translation start in mRNA.

4a. False, a wobble allows the anticodon in the tRNA to hybridize with different codons in mRNA.

b. False, a frameshift mutation affects all the subsequent amino acids.

c. False, only one codon (AUG) encodes for the start of protein synthesis; three codons signal the end of protein synthesis.

d. False, the wobble is first base (5’ to 3’) in the anticodon.

e. True, RNA can be used as a template for DNA synthesis in a process known as reverse transcription.

f. True.  For example, a single base substitution causing CAT to change to AAT would signal a termination.

g. False, the Wobble Hypothesis explains how alternate base pairing can occur with the first nucleotide (going from 5' to 3') in the anticodon.

5a. Digestion of RNA with alkali will cleave the strand after each 3’ phosphate.  Therefore, the products remaining will consist of pppNp, Np, and N-OH

b. If RNA was synthesized in the 3’ to 5’ direction (i.e. by adding ribonucleotides to the 5’ end), then the pppNp and Np fragments should be labeled with tritium.

c. If RNA was synthesized in the 5’ to 3’ direction (i.e. by adding ribonucleotides to the 3’ end), then the Np and N-OH fragments should be labeled with tritium.

d. Since the N-OH fragments were labeled with tritium, RNA synthesis must occur in a 5' to 3' direction.

6. In a missense mutation, the new nucleotide alters the codon so as to produce an altered amino acid in the protein product.  With a nonsense mutation, the new nucleotide changes a codon that specified an amino acid to one of the stop codons (TAA, TAG, or TGA). Therefore, translation of the messenger RNA transcribed from this mutant gene will stop prematurely.

Explanation:

You might be interested in
Please help with number 1 and 2
Ivenika [448]
Cuticle is to prevent water loss and the stomata placing in the bottom can reduce the evaporation of water because if it's place on top the sun will evaporate the water inside
6 0
3 years ago
Select three sports that require participants to be highly fit before the beginning
tangare [24]
I believe the answer is C. E. And F.
4 0
3 years ago
Read 2 more answers
What biomolecule is useful for a fast source of energy?
MissTica

Carbohydrates are useful for a fast source of energy.

<h3>What are Carbohydrates?</h3>

The body swiftly breaks down simple carbs for use as fuel. Natural sources of simple carbs include fruits, milk, and dairy products. They can also be discovered in sugars that have been processed and refined, such as confectionery, table sugar, syrups, and soft drinks.

<h3>What food is in carbohydrates?</h3>

A vast variety of both good and bad foods, including bread, beans, milk, popcorn, potatoes, cookies, spaghetti, soft drinks, corn, and cherry pie, include carbohydrates. They can take on various shapes as well. It is prevalent and plentiful in starches, fibers, and sugars.

<h3>What are examples of the three types of carbohydrates?</h3>

The three forms of carbohydrates—sugar, starch, and fiber—often referred to as simple or complex carbohydrates, each has a role in your diet. Sugar is a simple carbohydrate made up of mono- and disaccharides. Polysaccharides are complex carbohydrates, which include fiber and starches.

To learn more about carbohydrates visit:

brainly.com/question/14614055

#SPJ4

3 0
1 year ago
Drag the tiles to the correct boxes to complete the pairs.
Kitty [74]

Answer:

The answer is

Padded Toes for movement

Green skin to hide from predators

To maintain homeostasis they have permeable skin

To obtain food they have a long tongue to catch it.

Explanation:

4 0
2 years ago
What led scientists to accepting mendel's ideas
satela [25.4K]
I think they discovered chromosomes in DNA so that backed up his Idea
<span />
5 0
3 years ago
Other questions:
  • Bree and Eric are both in their 40s. They have spent their early adult years focusing on their education and careers. Now that t
    14·1 answer
  • A client with stage ii ovarian cancer undergoes a total abdominal hysterectomy and bilateral salpingo-oophorectomy with tumor re
    11·1 answer
  • The species that are most vulnerable to extinction are those, which are
    10·1 answer
  • Which events occurred during the Space Race? Select three options.
    13·2 answers
  • How much percent of biodiversity on land will be lost if all rain forests are destroyed?
    13·1 answer
  • The hydrologic cycle maintains a balance of Earth's water because _____.
    10·2 answers
  • ito ay tamang paggamit ng tamang bantas sa pagsulat ng isang suring pelikula upang maging epektibo ang pagsulat​
    10·1 answer
  • Which question is testable?
    7·1 answer
  • what is Found on outer edges of the phospholipid bilayer and provides structural support to the cell membrane.
    5·1 answer
  • In this project, you will analyze claims about the causes of inherited genetic variation. You will then make your own claim base
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!