1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
egoroff_w [7]
2 years ago
14

HELP PLEASE WILL GIVE BRAINLY! What is a complementary RNA strand to AGA?

Biology
1 answer:
Irina18 [472]2 years ago
5 0

Answer:Problem Set 4 Answers

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d. The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

2. Below is a table for the genetic code:

T

C

A

G

T

TTT Phe (F)

TTC "

TTA Leu (L)

TTG "

TCT Ser (S)

TCC "

TCA "

TCG "

TAT Tyr (Y)

TAC "

TAA Stop

TAG Stop

TGT Cys (C)

TGC "

TGA Stop

TGG Trp (W)

C

CTT Leu (L)

CTC "

CTA "

CTG "

CCT Pro (P)

CCC "

CCA "

CCG "

CAT His (H)

CAC "

CAA Gln (Q)

CAG "

CGT Arg (R)

CGC "

CGA "

CGG "

A

ATT Ile (I)

ATC "

ATA "

ATG Met (M)

ACT Thr (T)

ACC "

ACA "

ACG "

AAT Asn (N)

AAC "

AAA Lys (K)

AAG "

AGT Ser (S)

AGC "

AGA Arg (R)

AGG "

G

GTT Val (V)

GTC "

GTA "

GTG "

GCT Ala (A)

GCC "

GCA "

GCG "

GAT Asp (D)

GAC "

GAA Glu (E)

GAG "

GGT Gly (G)

GGC "

GGA "

GGG "

a. The following codons can be mutated by one base to produce an amber codon:

CAG    Gln

AAG    Lys

GAG    Glu

TCG    Ser

TTG    Leu

TGG    Trp

TAA    Stop

TAT    Tyr

TAC    Tyr

b. From part a, CAG (Gln) and TGG (Trp) can become amber stop codons through EMS.

c. From part b, both of the resulting amber codons could be suppressed by amber nonsense suppressors generated by EMS.

3a. The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain.  The anticodon is the complementary three nucleotide sequence in the appropriate tRNA.

b. Template strand is the DNA strand off which the mRNA is synthesized.  The coding, or non-template, strand is the DNA strand complementary to the template strand; it has the same sequence (except for T for U substitutions) as the mRNA.

c. The Pribnow box is a sequence of six nucleotides (TATAAT) positioned at -10 that signals where transcription initiation should begin in prokaryotic DNA.  The Shine-Delgarno sequence is a short, purine-rich region in the mRNA that is complementary to the rRNA within the 16S ribosomal subunit.  The sequence signals which AUG acts as the translation start in mRNA.

4a. False, a wobble allows the anticodon in the tRNA to hybridize with different codons in mRNA.

b. False, a frameshift mutation affects all the subsequent amino acids.

c. False, only one codon (AUG) encodes for the start of protein synthesis; three codons signal the end of protein synthesis.

d. False, the wobble is first base (5’ to 3’) in the anticodon.

e. True, RNA can be used as a template for DNA synthesis in a process known as reverse transcription.

f. True.  For example, a single base substitution causing CAT to change to AAT would signal a termination.

g. False, the Wobble Hypothesis explains how alternate base pairing can occur with the first nucleotide (going from 5' to 3') in the anticodon.

5a. Digestion of RNA with alkali will cleave the strand after each 3’ phosphate.  Therefore, the products remaining will consist of pppNp, Np, and N-OH

b. If RNA was synthesized in the 3’ to 5’ direction (i.e. by adding ribonucleotides to the 5’ end), then the pppNp and Np fragments should be labeled with tritium.

c. If RNA was synthesized in the 5’ to 3’ direction (i.e. by adding ribonucleotides to the 3’ end), then the Np and N-OH fragments should be labeled with tritium.

d. Since the N-OH fragments were labeled with tritium, RNA synthesis must occur in a 5' to 3' direction.

6. In a missense mutation, the new nucleotide alters the codon so as to produce an altered amino acid in the protein product.  With a nonsense mutation, the new nucleotide changes a codon that specified an amino acid to one of the stop codons (TAA, TAG, or TGA). Therefore, translation of the messenger RNA transcribed from this mutant gene will stop prematurely.

Explanation:

You might be interested in
Which physical property is the rate at which
Damm [24]
I is answer. Don't open link. It is most likeky unsafe.
6 0
3 years ago
What could be the possible result of founder effect on genetic variation?
GaryK [48]
The possible result of the founder effect would be loss of genetic variation. The reason why this is so is because by definition, the founder effect is often considered to be the cause for a essened genetic variation in a specie or a certain area where organisms thrive. 
3 0
3 years ago
A delta fibers can rapidly transmit pain information to the brain because
kirill [66]
<span>A delta fibers can rapidly transmit pain information to the brain because alpha delta fiber is a type of sensory nerve fiber. Aδ fibers carry cold, pressure and some pain signals. Because Aδ fibers are thinly myelinated, they send impulses faster than unmyelinated C fibers, but more slowly than other, more thickly myelinated "A" class fibers.</span>
6 0
3 years ago
If you were charged for collateral protection insurance on a
Andrew [12]

If you were charged for collateral protection insurance on a Wells Fargo auto loan, you could receive a cash payment from a class action settlement.

This statement is TRUE.

This is because if something happens to the collateral in the hands of a lending institution, you can receive compensation and this is known as Notice of Proposed Settlement of Class Action (“Notice”) and is authorized by the government.

<h3>What is collateral protection insurance?</h3>

This refers to the type of insurance that insures property that is on hold as collateral by a financial institution.

Hence, we can see a class action settlement has to do with the proceeds of financial rewards that is gotten as a result of winning a class action lawsuit and involves payment to a defendant.

With this in mind, we can see that you can receive compensation and this is known as a Notice of Proposed Settlement of Class Action (“Notice”) if you proceed with a class action lawsuit.

Read more about collateral protection insurance here:

brainly.com/question/14307346

#SPJ1

5 0
2 years ago
1.<br> What is one type of feature that results from wind deposition?
Igoryamba

You could answer with Loess or Sand dunes to the question as they are both results from wind deposition

5 0
2 years ago
Other questions:
  • Drinking five ounces of wine is better for the body than drinking twelve ounces of beer because there's less pure alcohol in a g
    14·2 answers
  • What are the roles of biosphere and ecosystem
    6·2 answers
  • Please help me it's easy guys
    15·1 answer
  • A scientist is testing the effectiveness of Drug X on cancer. She gives a small amount of the drug to mice that have cancer. She
    8·2 answers
  • In the last part of this activity, you clicked the reset button to draw the air out of the intrapleural space and return the lun
    13·1 answer
  • what are seven easily observable characteristics of all living things ? ( please help will give braineliest) ​
    9·1 answer
  • Which part of the eye is the opening through which light initially passes?
    6·1 answer
  • Normal urine is usually pale yellow to amber in color, due to the presence of
    11·2 answers
  • In the soybean respiration experiment, why were glass beads added in the non-germinating seed tube?
    8·1 answer
  • 1. What effect does the music have on the murals as Sierra and Robbie danced?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!