1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anna [14]
2 years ago
5

what is Found on outer edges of the phospholipid bilayer and provides structural support to the cell membrane.

Biology
1 answer:
kifflom [539]2 years ago
6 0
Hydrophilic or water loving am not really sure ooo
You might be interested in
Can you help me with this question?
netineya [11]

Answer:

can you shoot it better because it is quite blurry

6 0
3 years ago
Predict when an author might want to use first-person narrator point of view for a story.
Arada [10]
I would say C.
I hope this helps.
3 0
3 years ago
If female deer mates with male deer that have large antlers 2 we are witnessing_____ selection.
valkas [14]
The answer would be natural selection.

The female deer might consider the large antlers of the male deer to show of certain genetic qualities that have a higher probability of reproduction, as well as a higher social status among  deers. 

This means that if she picks him as her mate during this season, their offspring will have a better chance of survival compared to her picking another deer with smaller antlers.

This is called natural selection because she will pick the deer that is most adapted to that environment. Thus their offspring can be ensured to have the highest possible probability to survive. 
3 0
3 years ago
This space station has plants growing inside it, and astronauts who eat the fruits and vegetables from those plants. Because it
ruslelena [56]
Photosynthesis uses sunlight energy to make glucose (energy stores). A by-product of photosynthesis is oxygen. plants use water and sunlight to grow and they produce oxygen. Animals eat plants, use oxygen and breathe out carbon dioxide. Since the space station is in the shadow of the earth, the plants are unable to complete the process of photosynthesis and the carbon dioxide that is being produced by the humans cannot be utilized by the plants due to no sunlight. Therefore the carbon dioxide is going to continue to build up as the energy storage molecules are being depleted and not replenished.
8 0
2 years ago
What is the most important action for all students to take to stay safe in a science lab? Follow all instructions that are given
Luden [163]
I would say A. Mainly because the teacher is well trained for situation where it's critical or something like that.. 
7 0
3 years ago
Read 2 more answers
Other questions:
  • If a cell were treated with poison to block to function of its michocondria which of the following would be likely result?
    14·1 answer
  • What is a function of the ground tissue of a root
    13·1 answer
  • You are the scientific consultant for a television show about forensic analysis. In an upcoming episode, investigators will comp
    15·2 answers
  • Which pair of statements best describes an essential amino acid?
    15·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • PLEASE HELP FAST<br> NO LINKS OR TROLL ANSWERS I WILL REP0RT
    7·1 answer
  • The diagram shows a bacterium. Which labels best complete the diagram
    15·1 answer
  • Now write the mRNA strand for the given DNA strand​
    11·1 answer
  • Please answer quick and correctly
    15·1 answer
  • Environmental factors typically activate genes in a cell by causing the cell to --
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!