1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
trasher [3.6K]
3 years ago
9

HELP PLEASEEEEEE List things that are a part of a birds Cardiovascular System.

Biology
2 answers:
Ulleksa [173]3 years ago
5 0

Answer:Birds, like mammals, have a 4-chambered heart (2 atria & 2 ventricles), with complete separation of oxygenated and de-oxygenated blood. The right ventricle pumps blood to the lungs, while the left ventricle pumps blood to the rest of the body.

Explanation:

GarryVolchara [31]3 years ago
3 0

Answer:

Blood.

The heart.

The right side of the heart.

The left side of the heart.

Blood vessel.

Arteries.

Capillaries.

Veins.

You might be interested in
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
2 years ago
2. What are three examples of carbohydrates?
o-na [289]
Like bread and chips
6 0
3 years ago
Read 2 more answers
What are the three types of axonometric projection?
Shkiper50 [21]
Three types of axonometric projection<span> are </span>isometric projection,  trimetric projection. and dimetric projection.
6 0
2 years ago
explain why a father with blood group AB cannot donate for a child with blood group O when he marries a woman with blood group O
denis-greek [22]

The odds are astronomical for a father with AB(IV) to have an O(I) child. The only possible way for this phenomenon to occur is if there was a nondisjunction in the ovogenesis for the 9th chromosome and the father also had a nondisjunction for the same chromosome(A sperm cell with no 9th chromosome fertilized an ovum with two 9 chromosomes).

A person with AB cannot donate to a person with O because the receiver has antibodies(alpha and beta) that bind to the antigens on the AB blood cells, causing death.

7 0
3 years ago
A student identifies the following parts of a cell.
Molodets [167]

Answer:

mitochondrion becoz it is a membrane bounded organelle which is only present in eukaryotic cell

3 0
3 years ago
Other questions:
  • A researcher collected archaea and protists from a thermal vent. how do the cells of these two organisms differ?
    5·1 answer
  • Natural selection works to produce change at which of the following levels?
    13·1 answer
  • What happens during G2 phase
    5·1 answer
  • Compare anaerobic and cellular respiration
    11·1 answer
  • The layer of the atmosphere where most of our weather occurs is called
    7·1 answer
  • You maintain internal body temperature through negative feedback mechanism. Which of the following is a response to decrease bod
    14·1 answer
  • 3. Fill in the table below by writing the strand of mRNA that would be formed by each strand of DNA. Hint:
    7·1 answer
  • Which characteristics is common to all three groups of reptiles?
    12·2 answers
  • What's the placement of Saturn in the solar system?
    14·1 answer
  • What is living things and non-living things and non-living things ​
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!