1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
maxonik [38]
3 years ago
12

Only answer if you have an answer to one of the questions. Thank you.

Biology
2 answers:
nadezda [96]3 years ago
8 0

Answer:

4.

An internal stimulus is a stimulus that comes from inside an organism. You may have experienced an internal stimulus of hunger after a long day at school, and this prompts you to eat some food in order to regain needed energy

Rainbow [258]3 years ago
8 0
3. It means that every aspect in this world has its own process of development and undergoes a change where they accumulate growth
You might be interested in
Which answer has the correct order for the four phases of mitosis?
seraphim [82]

Answer:

PMAT

Explanation:

3 0
3 years ago
Read 2 more answers
How do you know if something is alive? Please help me describe some of the characteristics of living things.
Feliz [49]

Answer:

In order for something to be classified as living, it must grow and develop, use energy, reproduce, be made of cells, respond to its environment, and adapt. While many things meet one or more of these criteria, a living thing must meet all of the criteria.

8 0
3 years ago
In addition to the elements found in carbohydrates, proteins contain the element nitrogen.
Paraphin [41]
True, all proteins contain nitrogen.
5 0
3 years ago
Read 2 more answers
What is a polymer? Give an example.
Luden [163]

Answer:

A polymer is a substance that has a molecular structure consisting chiefly or entirely of a large number of similar units bonded together

Synthetic Polymers:  nylon, polyethylene, polyester, Teflon, and epoxy.

Natural Polymers: silk, wool, DNA, cellulose and proteins

7 0
3 years ago
State how a deep current forms
pentagon [3]
 <span>Deep currents are driven by water temperature differences (warm at the equator, cold at the poles).</span>
5 0
3 years ago
Other questions:
  • Read the two statements given below.
    11·2 answers
  • All of the following are true facts about enzymes EXCEPT
    14·2 answers
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • Why are we not able to see viruses with the compound light microscopes?
    8·1 answer
  • Good mental health is the ability to __________.A.express feelings appropriatelyB.allow daily situations to cause excessive anxi
    5·2 answers
  • In an animal cell, which two cell structures do newly-synthesised enzymes have to pass through to reach the external environment
    6·1 answer
  • Please help me! BOTTOM QUESTION ONLY!!! Thanks!!
    14·1 answer
  • How have plants adapted to different environmental conditions?
    5·1 answer
  • What is the process of photosythesis
    5·2 answers
  • Which force acts when one object moves against another object?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!