1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ivolga24 [154]
3 years ago
10

6. Based on the food web above, hunting of sharks by humans has increased in international waters. How

Biology
1 answer:
photoshop1234 [79]3 years ago
8 0

Answer:

Short term: The fish (that sharks feed on) increase, the aquatic plants decrease

Long term: The fish (that sharks feed on) decrease, the aquatic plants increase

Explanation:

Short term: The fish increase because the sharks that used to feed on them decrease hence they get eaten less. The increased fish eat a lot of plants hence aquatic plants decrease.

Long term: The increased fish will then compete for the few aquatic plants present. Only the stronger fish survive hence most fish starve and die. Less fish means that the aquatic plants are being eaten less thus the aquatic plants increase.

You might be interested in
Question 9 of 10
miv72 [106K]
Glycolysis Explained in 10 Easy Steps
Step 1: Hexokinase. ...
Step 2: Phosphoglucose Isomerase. ...
Step 3: Phosphofructokinase. ...
Step 4: Aldolase. ...
Step 5: Triosephosphate isomerase. ...
Step 6: Glyceraldehyde-3-phosphate Dehydrogenase. ...
Step 7: Phosphoglycerate Kinase. ...
Step 8: Phosphoglycerate Mutase.
5 0
3 years ago
A young man is struck on the cheek by a baseball and sustains an injury in which the skin is not broken and the cheekbone is not
nirvana33 [79]

Answer:

Answer is A. Profuse bleeding.

Explanation:

The acute response can be described as an early or immediate response of the tissue to injury. It is always for a short period of time.

Acute inflammation involves some processes which are initiated in order to limit damage to tissues.

The acute inflammatory process include pain, redness, immobility, swelling and heat.

In this case, profuse bleeding is the only one that is not part of the processes.

Therefore, the young man will not experience profuse bleeding.

3 0
3 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Plants,algae,and cyanbacteria all release.......as waste that animals use to breathe
Sati [7]

Answer:

oxygen

Explanation:

all engage in oxygenic photosythesis (top equation), which means that they require water and release oxygen

8 0
3 years ago
The connecting piece of a sperm is packed with what that produces energy?
devlian [24]
The answer to this is Gonads. 
8 0
3 years ago
Other questions:
  • Why doesn't the moon move away from earth
    12·2 answers
  • Fungal cell walls are composed of what material?
    7·1 answer
  • Decomposers break down the remains of organic material and return it to the soil. Which populations in a forest ecosystem does t
    5·1 answer
  • It has been suggested that scientists should attempt to genetically engineer a plant to have black leaves so that it would perfo
    5·1 answer
  • During the day when the sun is shining the ground gets warm mainly as a result of
    11·1 answer
  • How is a pedigree chart interpreted?
    15·1 answer
  • Which ancient culture is not know for using geothermal energy?
    13·2 answers
  • Lactic acid fermentation can be modeled by which equation?
    11·1 answer
  • What feature can increase animals odds in reproducion
    9·1 answer
  • A blood sample is taken from a blood spatter pattern at a crime scene. the blood was found to be type a . since the primary susp
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!