1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sever21 [200]
3 years ago
7

How fast can you answer how fast can i mark u brainliest???

Biology
1 answer:
OverLord2011 [107]3 years ago
6 0

Answer: A

Explanation: Stainless steel

You might be interested in
Which trait did Gregor Mendel examine from the pea plant when he planned his study?
Kryger [21]
Ur answer would be D
6 0
3 years ago
Allows neurons to speed up the transmission of nerve impulses.
elena-14-01-66 [18.8K]

Answer:

The Myelin Sheath allows neurons to speed up the transmission of nerve impulses.

4 0
3 years ago
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
Genes are parts of the dna that contain
forsale [732]

Answer:

genes are part of the DNA that contain traits from ur biological parents that basically make u who u r

3 0
3 years ago
Read 2 more answers
17. Which of these processes is the result of the motion of particles in a gas or liquid?
BartSMP [9]

Answer:

B

Explanation:

4 0
3 years ago
Other questions:
  • The wild-type color of horned beetles is black, although other colors are known. a black horned beetle from a pure-breeding stra
    8·1 answer
  • Sponges have collar cells that trap food and ingest it by proteasespinocytosisphagocytosis or by the enzymes of lysosomes
    13·2 answers
  • what is the sample that goes through all the steps of an experiment but does not contain the factor being tested?
    9·1 answer
  • Which process can produce a large number of offspring?
    15·1 answer
  • What best describes a gamete
    13·2 answers
  • What causes an unsaturated fatty acid to have a different shape than a
    7·1 answer
  • The Earth's crust is part of which sphere? lithosphere biosphere hydrosphere atmosphere PLS ASAP HELP PLS
    8·2 answers
  • What can be used as both a moderator and a coolant in nuclear power plants?
    9·1 answer
  • Analyzing data in graphs or charts allows you to?
    9·1 answer
  • In 1987, the population of Black Footed Ferrets in the world was 18 individuals. By 1989 through captive breeding, the number ro
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!