1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
liubo4ka [24]
3 years ago
15

lipuid 1 reacts with liquid 2 , prodducing a solid and a gas. using this secnerio, which supports the law of conservation of mas

s
Biology
1 answer:
Vika [28.1K]3 years ago
4 0

Answer: mass of Liquid 1 + mass of Liquid 2 = mass of solid + mass of gas

Explanation:

You might be interested in
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Which president established the U.S. Environmental Protection Agency? Richard Nixon John Kennedy Jimmy Carter Bill Clinton
Illusion [34]

Answer:

richard nixon

Explanation:

hope it helps

5 0
3 years ago
How does the body avoid damaging the digestive enzymes in the small intestine
expeople1 [14]

Answer:

As the stomach contents pass from the stomach to the small intestine, their acidity is rapidly neutralized by the addition of HCO3- produced by the pancreasa good thing, too, because the mucosa of the small intestine has no other protection against HCl.

8 0
3 years ago
The Punnett square predicts the ratio of genotypes in the offspring, based on the genotypes of the parents. The Punnett square b
grigory [225]

Answer:

75%

Explanation:

Three of the boxes contain an Upper case F, therefore 75% of the boxes have an Upper case F. It's like quarters, if you have 4 quarters you have 100 cents, if you have 3 you have 75 cents, if you have 2 you have 50 cents, and if you have 1 you have 25 cents.

7 0
3 years ago
How is the birth rate different from the rate of natural increase?
Furkat [3]
The difference<span> between the </span>birth rate<span> and the death </span>rate<span> of a country or place is called the </span>natural increase<span>. </span>
8 0
3 years ago
Other questions:
  • What structures do sponges possess that may prevent other animals from eating them?
    11·2 answers
  • How many dna molecules are in each somatic cell?
    13·2 answers
  • Is the ocean considered a landform?
    7·2 answers
  • To avoid constipation, pregnant women should increase intake of
    6·1 answer
  • How does plate tectonics explain the combination of low-temperature but high-pressure minerals found in a blueschist?
    15·1 answer
  • BRAINLIESTTT ASAP!!!
    5·2 answers
  • Compare the stucture of a food web with a food chain
    13·1 answer
  • According to the graph, which renewable energy resource did the United States use MOST during 2007?
    12·2 answers
  • The incidence of skin cancer has increased dramatically in parts of Australia where people are experiencing greater UV exposure
    12·1 answer
  • Which substances will float on water? (there are eleven, name all of them)
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!