1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
34kurt
3 years ago
8

Which was the earliest method used to determine stellar distances? A. supernovae B. parallax C. cepheids variables D. redshift m

easurement
Biology
1 answer:
Natasha_Volkova [10]3 years ago
3 0

Answer:

Parallax

Explanation:

Trust me I've done this

You might be interested in
What statement best describes the relationship between the products of photosynthesis and the reactants in cellular respiration
zalisa [80]

The products of photosynthesis is to gain energy and build compounds, like glucose from carbon dioxide, making it anabolic

The reactants of cellular respiration are catabolic, and that refers to the breaking down of compounds, which releases energy.

The relationship is that they're complex compounds that consist of materials coming from essential processes in the cell.

8 0
3 years ago
Which of the following products are derived from invertebrates? food shell jewelry silk cottonshell products are derived from in
Elden [556K]
SHELL products are derived from invertebrates.
3 0
3 years ago
What is land pollution?
Gwar [14]
When people throw their garbage on the ground
3 0
3 years ago
1) How is DNA compacted to form a chromosome?
denis-greek [22]

Answer: Answer is below in the explanation.

Explanation:

As shown in the animation from my school, a DNA molecule wraps around histone proteins to form tight loops called nucleosomes. These nucleosomes coil and stack together to form fibers called chromatin. Chromatin, in turn, loops and folds with the help of additional proteins to form chromosomes.

(Link my school used https://www.biointeractive.org/classroom-resources/how-dna-packaged )

6 0
3 years ago
Read 2 more answers
Which of these is a likely goal of scientists involved in the Human Genome Project?
oksano4ka [1.4K]

Answer:

B. to understand the function of genes that are effected by disease

Explanation:

i took the test

5 0
3 years ago
Other questions:
  • A functional group on an amino acid that is polar and can become positively charged: ___________
    7·1 answer
  • What did cecilia payne -gaposchkin (say;gah-posh-kin) discover about astronomy?
    13·1 answer
  • Earthquakes are most abundant along the?
    8·1 answer
  • I don't really understand the question.
    5·2 answers
  • What type of cell has larger vacuoles a. archaea b. plant c. animal d. fungi
    15·1 answer
  • Whales have a pelvic and leg bone, even though they do not walk on their legs. Which term is used by scientists to describe this
    8·1 answer
  • Help on these please
    11·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • Which BEST
    5·1 answer
  • Down syndrome is the result of an extra chromosome 21. Which type of mutation is down syndrome
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!