Answer:
The reason hydrogen bonding occurs is because the electron is not shared evenly between a hydrogen atom and a negatively charged atom.
Explanation:
Hydrogen in a bond still only has one electron, while it takes two electrons for a stable electron pair. Any compound with polar covalent bonds has the potential to form hydrogen bonds.
The answer is A. may reveal greater unknown complexities, computer models only show what we put it into it and what we mostly know.
Answer:
Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT
TTAAGCGGCCATAATCTGCAA
Explanation:
Answer:
thylakoid membrane
Explanation:
The green pigment chlorophyll is located within the thylakoid membrane, and the space between the thylakoid and the chloroplast membranes is called the stroma
The answer is B because soil is not just to hold plants in the ground they support life such as worms
