1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
a_sh-v [17]
3 years ago
9

Which of the following is a function of the nucleus in organism 2?

Biology
1 answer:
Dahasolnce [82]3 years ago
7 0

Answer:

The nucleus is an organelle found in most eukaryotic cells, the exception being red blood cells. ...

The primary functions of the nucleus are to store the cell's DNA, maintain its integrity, and facilitate its transcription and replication.

You might be interested in
In what kind of star system does one star sometimes block the light from another?
Romashka [77]
I think the answer is 3 or 2 i
5 0
3 years ago
1. What happens to the cell membrane during endocytosis?
Yanka [14]

Answer:

The cell membrane will fold over a substance or particle until it becomes completely enclosed by the membrane

Explanation:

Endocytosis is when a substance or particle from the outside is captured and engulfed by the cell membrane until it is in the inside.

8 0
3 years ago
What appears to be the role of sirna in destroying the target mrna upon which it and its associated proteins act? it cleaves the
Romashka-Z-Leto [24]
<span>siRNA guides the RISC that cleaves the target mRNA. siRNA binds to its target mRNA due to its complementarity.</span> <span>Small interfering RNA (siRNA) has a function in RNA interference, which means it causes gene silencing through repression of transcription. siRNA together with some proteins (like Argonaute) form the RISC. When siRNA recognize the target mRNA it causes degradation of mRNA and thus silencing the gene that encodes that mRNA.</span>
8 0
3 years ago
What is the advatage of the epidermis being transparent
dmitriy555 [2]
The advantage of the epidermis being clear is that the light can pass by easily without a problem. If we could not let the light pass we would have no pigmentation and that means we would have no skin tone. We would all just be really white and out pigmentation would not be there.
8 0
3 years ago
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
Other questions:
  • When artery muscles contract, _____.
    9·1 answer
  • How does the apparent size of an object depend on its distance from the observer?
    9·1 answer
  • In which phase of mitosis, do sister chromatids separate to become daughter chromosomes?
    13·1 answer
  • In the snail pomacea patula catemacensis, n = 13. what is the diploid number for this organism?
    10·1 answer
  • 8. _______ are similar to special committees used to prepare for an event. They're useful in planning anything from the rules of
    5·2 answers
  • A 19-year-old male complains of "not feeling right." his insulin and a syringe are on a nearby table. the patient says he thinks
    10·2 answers
  • How do organisms that are not autotrophs get they energy they need to sustain life?
    13·1 answer
  • 5. What happens as pigments are mixed together?
    9·1 answer
  • Hello guys, Define wave length.I think this will be easy for u guys good day thank u​
    14·2 answers
  • Both primary and secondary active transport depend directly on _______ to move substances across a cell membrane.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!