Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
Answer:
a state of sustained partial contraction
Explanation:
Simply said, muscle tone means that there is a sustained tension in a muscle wile in a determinate posture. The muscle tone enable us to mantaing our bodies in a posture fit for resting or for also working, like sitting, being stand up or in a couch or sleeping. The changes in the muscle tones make us able to move. So contractions will follow depending what activity we are engaged on, as a continous and passive partial contraction of muscles change following changes in direction.
Muscle tones have contractions that do not produce enough tension to move, buy they keep it tense and firm.
Thererefore the tension is balanced and resting muscle tone balances bones and joints.
See below :)
In physiology, medicine, and anatomy, muscle tone (residual muscle tension or tonus) is the continuous and passive partial contraction of the muscles, or the muscle's resistance to passive stretch during resting state. It helps to maintain posture and declines during REM sleep.
Answer:
D.
Explanation:
The reactants used in photosynthesis are H2O(water), CO2(carbon dioxide), and light(sunlight) energy. These are used to produce glucose for the plant and oxygen which is released.
Hope this helps!!! PLZ MARK BRAINLIEST!!!
The answer is underwater eathquakes.
Earthquakes are a shaking of the ground that when observed on earth, can cause many damages mainly on hills and mountainsides causing avalanches. When they occur underwater though, the water gets lifted (normally from the sea) and generates giant waves that can sometimes reach the coast.
Hope it helped,
BioTeacher101