1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
igor_vitrenko [27]
3 years ago
5

In a typical cell membrane, arrange themselves to form a ?

Biology
1 answer:
masya89 [10]3 years ago
4 0

Do you mean:

In a typical cell membrane, *phospholipids* arrange themselves to form a ?

In that case, the answer is:

Bilayer

You might be interested in
Assembling a complete sequence from fragment sequences
Soloha48 [4]

Answer:

"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.

Explanation:

The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.

7 0
3 years ago
Where do your inherited genes come from?<br> alleles<br> parents<br> gametes<br> offspring
kenny6666 [7]
Offspring hope this helps
8 0
3 years ago
Muscle tone is ________. the condition of athletes after intensive training the ability of a muscle to efficiently cause skeleta
Sedbober [7]

Answer:

a state of sustained partial contraction

Explanation:

Simply said, muscle tone means that there is a sustained tension in a muscle wile in a determinate posture. The muscle tone enable us to mantaing our bodies in a posture fit for resting or for also working, like sitting, being stand up or in a couch or sleeping. The changes in the muscle tones make us able to move. So contractions will follow depending what activity we are engaged on, as a continous and passive partial contraction of muscles change following changes in direction.

Muscle tones have contractions that do not produce enough tension to move, buy they keep it tense and firm.

Thererefore the tension is balanced and resting muscle tone balances bones and joints.

See below :)

In physiology, medicine, and anatomy, muscle tone (residual muscle tension or tonus) is the continuous and passive partial contraction of the muscles, or the muscle's resistance to passive stretch during resting state. It helps to maintain posture and declines during REM sleep.

6 0
2 years ago
What reactants are involved in photosynthesis? A. C2H4O2 and H2O and sunlight energy B. H2O and CO2 and chemical energy C. C2H4O
DerKrebs [107]

Answer:

D.

Explanation:

The reactants used in photosynthesis are H2O(water), CO2(carbon dioxide), and light(sunlight) energy. These are used to produce glucose for the plant and oxygen which is released.

Hope this helps!!! PLZ MARK BRAINLIEST!!!

5 0
3 years ago
What may cause a tsunami?
OlgaM077 [116]

The answer is underwater eathquakes.

Earthquakes are a shaking of the ground that when observed on earth, can cause many damages mainly on hills and mountainsides causing avalanches. When they occur underwater though, the water gets lifted (normally from the sea) and generates giant waves that can sometimes reach the coast.


Hope it helped,


BioTeacher101

3 0
3 years ago
Read 2 more answers
Other questions:
  • What are two ways in which a particle that is too large to fit through the cell membrane can enter the cell?
    8·1 answer
  • Which activities are ways to reduce the negative impacts humans have on Earths resources? Select two options
    9·2 answers
  • The following are steps in protein synthesis. Which is the first step that is out of order?
    12·1 answer
  • alcohol fermentation by yeast cells will provide them with energy (ATP) but produces ____ and ____ as waste.
    14·1 answer
  • Scientist who specialize in the study of fossils are called
    7·2 answers
  • During glycolysis, a six-carbon glucose reacts with oxygen to produce two three-carbon pyruvate molecules. Which molecules provi
    11·1 answer
  • In frogs, different mating seasons are a (n) to reproduction
    14·1 answer
  • Please fully explain the answer​
    7·1 answer
  • What do you already know about conservation? Think about wildlife and the environment
    6·1 answer
  • What would be the RNA strand produced after transcription?<br><br> 5' A-T-T-C-G-A-T-G-C 3'
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!