2 years ago

Select the correct answer.

Biology

2 answers:

wariber [46]2 years ago

7 0

Answer:

electricity its energy and force

Keith_Richards [23]2 years ago

6 0

Explanation:

We use electrical devices that produce motion, light, and sound. Which aspect of energy explains why these devices are possible?

<h2>see the attachment</h2>

<h2>hope it helps</h2>

(◍•ᴗ•◍)

You might be interested in

The following diagram shows various positions of the moon in its orbit around Earth. The image of the moon shows its phase as se

Natasha2012 [34]

The answer is D, I just took the test.

4 0

3 years ago

Earth's biosphere is described as

xxTIMURxx [149]

Answer:

the layer of the planet Earth where life exists

Explanation:

5 0

3 years ago

Read 2 more answers

what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC

VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0

2 years ago

In part of the model, materials move out of the bag and into the water. which

stepan [7]

Answer:

small molecules easily pass through the phospholipids in the cell membrane

4 0

2 years ago

A red-tailed hawk swoops down and captures a young rabbit feeding on dandelions growing in a park. the relationship between the

Rudiy27

The hawk, a carnivore (animal meat-eater), is predating on the rabbit, an herbivore (plant-eater). So the hawk can be seen as the predator and the rabbit as the prey.
But another type of relationship important in Ecology is consumers. So producers are the plants that feed a food web. That makes the rabbits the primary consumers (herbivores) of these plants. Then the hawks become the secondary consumers (carnivores) of the primary consumers, by eating the herbivores.
Hope that this makes sense!

4 0

3 years ago