Africa, australia, north america, south america, antarctica, asia, and europe
Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
Atom refers to a tiny particle, which is the basic building block of all the substances and whose properties determine the characteristics of an element made up of only of those atoms.
All the living and nonliving matter in this world are made up of atoms and elements. Everything in the universe is matter, and matter comprises elements. Some of the elements are important to living things.
Elements are formed by atoms, and atoms comprise protons, electrons, and neutrons. The number of protons in an element's atom signifies the identity of the element.
Answer:
Bog
Explanation:
A type of standing-water habitat in which the soil is acidic and decay is slow is called a <u>bog</u>.
In my opinion, no because a language is made up of sound that go together in order to create words and all non-primate 'languages' are made up of random sounds that only that species or other related to it can speak and understand