1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
egoroff_w [7]
3 years ago
6

What steps had to be taken before the building could be built?

Biology
1 answer:
Wewaii [24]3 years ago
4 0

Answer:

You will have to Create a Detailed Plan

You might be interested in
List all the seven continenets
ICE Princess25 [194]
Africa, australia, north america, south america, antarctica, asia, and europe

6 0
3 years ago
Read 2 more answers
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
Explain how the basic structure of an atom has led to the diversity of compounds making up living and nonliving things
kobusy [5.1K]

Atom refers to a tiny particle, which is the basic building block of all the substances and whose properties determine the characteristics of an element made up of only of those atoms.  

All the living and nonliving matter in this world are made up of atoms and elements. Everything in the universe is matter, and matter comprises elements. Some of the elements are important to living things.  

Elements are formed by atoms, and atoms comprise protons, electrons, and neutrons. The number of protons in an element's atom signifies the identity of the element.  


5 0
3 years ago
A type of standing-water habitat in which the soil is acidic and decay is slow is called a _____.
Roman55 [17]

Answer:

Bog

Explanation:

A type of standing-water habitat in which the soil is acidic and decay is slow is called a <u>bog</u>.

4 0
3 years ago
Consider how all animals, including human ones, communicate in some way. in your opinion, is non-human primate communication tru
qaws [65]
In my opinion, no because a language is made up of sound that go together in order to create words and all non-primate 'languages' are made up of random sounds that only that species or other related to it can speak and understand
5 0
3 years ago
Other questions:
  • Like all forms of life on earth, all microbial cells perform three major types of activities:
    8·1 answer
  • Select the correct answer.
    11·1 answer
  • What are protist considered animal like or fungus like or plantlike
    9·1 answer
  • Post parturient ketosis usually appears
    6·1 answer
  • True or False: The cells from the "Area of Cell Division" allow the root to grow longer?​
    13·1 answer
  • See the picture to help you. Its what you use to answer the question.
    6·2 answers
  • Why did the United States ban the use of DDT?​
    14·2 answers
  • What is most likely observed when the temperature of water increases and researches 100c ? A. The water begins to harden . B The
    6·1 answer
  • Is it true or false that plants and animals are made of cells
    15·2 answers
  • Put the steps into the correct order to describe iron deficiency anemia,
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!