1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
antiseptic1488 [7]
3 years ago
10

10. A covalent bond forms between two DLL

Biology
1 answer:
ASHA 777 [7]3 years ago
5 0

Answer:

A covalent bond forms between two Nonmetals!

Explanation:

A covalent bond always forms between the electrons of two Nonmetals.

hope it helps!

You might be interested in
What is overproduction?
Pepsi [2]
The answer is C. More offspring are produced than can survive.
4 0
3 years ago
Read 2 more answers
Which 3 beak types will most likely be present in surviving species
andriy [413]
Don’t click that link trust me
8 0
2 years ago
Calcium is a substance found in vitamins that people take to help strengthen their bones and teeth. Which plant has been used fo
lubasha [3.4K]

horsetails has similarly been used for strengthening bones n teeth

8 0
3 years ago
Read 2 more answers
What is the purpose of an election carrier
Maurinko [17]

Do you mean electron? If so they are molecules that transport electrons during cellular respiration.

4 0
3 years ago
The combined portions of earth in which all living things exist is called the
Svetach [21]

Answer:

The answer is the Biosphere.

Explanation:

A good way to remember this is to recall <em>'Bio'</em> means <em>'Life.'</em>

6 0
3 years ago
Other questions:
  • What might happen if the testes were located inside the body?
    15·1 answer
  • What is the name for the cycles resulting from changes in earth's movements and that may cause ice ages? answers?
    12·1 answer
  • What obtain their energy by decomposing dead and dying organisms
    15·1 answer
  • Describe the three major sources of energy that power earth's environmental systems
    8·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Organic compounds are made up of all except which of the following elements
    13·1 answer
  • A scientist bred fruit flies in two separate containers with different food sources for many generations. When she put the fruit
    6·2 answers
  • What is the relationship between an allele and a gene?
    11·2 answers
  • IN YOUR OWN WORDS, what is the definition for point mutation
    13·2 answers
  • Which of these particles is able to pass freely through a cell membrane? A. A nucleic acid molecule B. A disaccharide molecule A
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!