1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nikolay [14]
3 years ago
10

2.

Biology
1 answer:
Gekata [30.6K]3 years ago
7 0

Answer:

(A) O Increasing the number of chloride ion channels on the cell membrane

Explanation:

This is because options B, C and D require processes which make calcium available for the cell and homeostasis is the process of returning the cell back into its stable condition.

All other options except A do not help the cell return to its stable condition.

So, the answer is A

You might be interested in
What are the three parts of the cell cycle of a eukaryotic cell? what is the purpose of each part? where does it occur in the ce
Kisachek [45]
The Cell membrane-bound organelles, which carry out cell functions.
Nucleus, which contains the DNA cytoplasm.
The nucleus, the membrane-enclosed internal region that contains genetic material.
7 0
3 years ago
The temperature-volume relationship shown in the graph in the lesson represents: 1. an inverse linear function
lianna [129]
A direct linear function

A direct relationship is linear b/c they go in a straight line.
8 0
3 years ago
Read 2 more answers
An object moving at a constant velocity will ______.
Ivenika [448]
I believe the answer would be B.
6 0
3 years ago
Read 2 more answers
Granite was formed slowly as magma cools what is the result of this slow cooling
marta [7]

The answer would be Igneous rocks, because of magma cooling

6 0
3 years ago
Read 2 more answers
A hand cranked flashlight represents:
Misha Larkins [42]

Answer:

chemical to mechanical

5 0
2 years ago
Other questions:
  • When an organism moves or performs another form of work, what happens to the heat that is generated?
    9·1 answer
  • Which of the following is an example of localized irrigation?
    15·1 answer
  • 2. Most male crickets produce a mating song by rubbing together their curved
    10·1 answer
  • Rashad is studying for tomorrow's biology exam. He has been reading and taking notes for hours, and he feels like he cannot stud
    15·1 answer
  • A particle of rain water has just reached the ocean. In what order will the particle now complete the following steps of the wat
    14·1 answer
  • How can a geologist use the color of a fine-grained igneous rock to infer its composition?
    13·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Which of the following is NOT one of the four most common elements found in food?
    9·1 answer
  • What will be the effect of placing a plant cell in a hypotonic solution?
    12·1 answer
  • Near a stream's source, a stream erodes a piece of rock from its streambed. As the rock is carried down the stream, how will its
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!