1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Harrizon [31]
3 years ago
9

There are economic concerns surrounding the products that have been genetically engineered for particular traits, including phar

maceuticals, crops, and enzymes that are used in industry and manufacturing processes. Which is LEAST likely to be an economic concern that affects society? O patented products birth defects land use O cost of genetically engineered seeds​
Biology
1 answer:
enot [183]3 years ago
8 0

Answer:

other answer is right but they got the letter wrong, its answer B: Birth defects

Explanation:

You might be interested in
Which of these Earth spheres interacts with coral reefs to cause coral bleaching?
Svetllana [295]

Answer:

you need to attach a photo.

Explanation:

5 0
2 years ago
Why did Miller use ammonia , methane and hydrogen his experiment
ladessa [460]

Answer:

hold on

Explanation:

working on it

4 0
3 years ago
What should be your response as you approach a roundabout?
BigorU [14]
<span>The correct answer is B) choose the correct lane. It is always important when driving to ensure you are in the correct lane, but in roundabouts, it is essential to the traffic flow. Choice A is not correct because roundabouts are designed to slow down traffic and you need to be paying attention to what is going on and slowing down before you enter. Choice C is not correct because you do not have the right-of-way; the traffic already in the roundabout does and you would need to yield to them. Choice D is not correct because choices A and C are not correct.</span>
7 0
3 years ago
When the total lunar eclipse occurs what are the relative positions of the sun earth and moon
Dennis_Churaev [7]

Answer:

A lunar eclipse occurs when the Moon passes directly behind the Earth into its umbra (shadow). This can occur only when the sun, Earth and moon are aligned (in "syzygy") exactly, or very closely so, with the Earth in the middle.

Explanation:

3 0
3 years ago
Read 2 more answers
When a substance changes into a different substance, a _____ change has occurred.
Yuri [45]

a phase change occurs

e.g ice into water

4 0
3 years ago
Read 2 more answers
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Insulin is synthesized and released by the: brain. liver. pancreas. gallbladder.
    13·1 answer
  • 4. Using a complete sentence, state what would most likely happen to the production of oxygen by duckweed plants if the intensit
    6·1 answer
  • When a tapeworm steals nutrients from the gut of a mammalian host, that symbiosis is called?
    5·1 answer
  • {10points} What did people invented using anatomy of frog?
    5·1 answer
  • Why is it important to maintain accuracy during dna replication?
    14·1 answer
  • Which of the following cut flowers emits unusually large amounts of ethylene gas?
    14·1 answer
  • Hellooo help please! no random stuff just 50$$!! or coins-
    7·1 answer
  • What is the waste material liquid that is formed in the kidneys? _____
    15·2 answers
  • When were the first articles about the detection of poison in the body published?.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!