Answer:
Scientific Methodology involves the following procedures of
-observing and making enquires,
-formulating inferences and developing hypotheses,
-performing controlled experiments,
-gathering and evaluating data,
-and coming into conclusions.
Fragmentation is the breaking of the body into parts and then the organism develops all the parts of the body. The fragmentation is the type of reproduction in lower organisms. The fragments which are produced can develop into new organisms.
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
Answer:
Atoms and molicules
Explanation:
Positive, negative, and nutrol atoms mix together and make up everything
the world and that also includes making living things.
I am pretty sure the answer is c
