1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Andreyy89
4 years ago
10

Which organisms can cause contagious deceases?

Biology
1 answer:
jekas [21]4 years ago
5 0
Protozoans, bacteria, fungi... viruses are not organisms
You might be interested in
What chamber of the heart receives blood from the pulmonary veins? A. Right ventricle B. Left atrium C. Left ventricle D. Right
devlian [24]
Left atrium of the heart
4 0
4 years ago
Read 2 more answers
What is the shortest day of 2021? And What is the Longest Day 2021?
Doss [256]

Answer:

June 21st is the longest day of the year December 21st is the shortest

Explanation:

4 0
3 years ago
Read 2 more answers
Two heterozygous loonas are crossed. What proportion of the offspring will have black hair?
maw [93]

Answer:

25%

Explanation:

(I'm guessing "loonas" does not mean black)

as you can see in the picture 25% is ll or black

4 0
4 years ago
Which symptom would an individual with a narrow foramen most likely experience?
igor_vitrenko [27]

Answer:

its A. back pain from the compressed nerves

4 0
3 years ago
The physical expression of genes
spin [16.1K]

The physical expression of genes are phenotype. Phenotype is the expression of the gene by the appearnace of the organism. It is the characteristics of that trait.

Examples : When pigment is made in our eyes, height ( tall and short) , weight, blond hair is the phenotype for the blond hair genotype and skin colour( black, white ) is the phenotype trait.

4 0
4 years ago
Read 2 more answers
Other questions:
  • 4.) What can a Punnett Square be used to determine?*.
    10·1 answer
  • 21. When did the Precambrian era end?
    7·2 answers
  • Adrian caught a virus while staying with his grandmother. A few years later, his mother and sister got the same virus. This viru
    11·1 answer
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • How are the mutations in GENOME simiar to a printinting book
    13·1 answer
  • Groups of tissues with specialized function
    13·1 answer
  • On the pH scale, a 7 indicates _____. <br> a base<br> an acid<br> neutrality
    5·1 answer
  • • HURRY PLEASE•<br> ↓↓↓↓↓↓↓↓↓↓↓
    5·1 answer
  • In a transformation experiment, a sample of E. coli bacteria was mixed with a plasmid containing the gene for resistance to the
    6·1 answer
  • ______ are found in the
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!