1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gladu [14]
3 years ago
5

Why do you think there is more plant growth yearly at the equator compared to Maryland?

Biology
1 answer:
Dafna1 [17]3 years ago
6 0

Answer: Because of the heat difference.

Explanation:

Now can you anwser mine?

You might be interested in
Vaccines cure disease<br> O True<br> O False
anyanavicka [17]

Answer: False The vaccines help to prevent them and sometimes cure them.

3 0
3 years ago
Read 2 more answers
What is the most famous astranots name
Inga [223]

Answer:

Neil Armstrong

Explanation:

5 0
3 years ago
Can anyone of you help me
Dafna11 [192]
I believe is winter
5 0
3 years ago
An interviewer has a list of prepared questions to ask each candidate. However, the interviewer also finds it useful to ask some
miskamm [114]

Answer: close ended

Explanation:

In a job oriented interview both open and closed ended questions are asked to the job seeker. The open ended interview questions are generally very long answer type questions these questions allows the person to express. These questions are asked to learn about the personality and interests of the job seeker. The closed ended questions are the short questions and they are easy to answer and these can be answered in yes and no. These questions are asked and answered quickly. The chances of mistakes in these questions are more. The chances of misinterpretation of the question is always more in these questions. But these questions allow to get more information about the candidate as compared to the open ended questions as during the open ended question session the job seeker can manipulate the facts but in the case of close ended questions the asking tendency is rapid so no manipulation can occur.

8 0
3 years ago
Read 2 more answers
5. Samantha's hair dryer uses 660 Watts of power from a source of 110 V. the resistance?
Marina CMI [18]

Answer:

The resistance of the wire is <u>7.7</u>.

8 0
3 years ago
Read 2 more answers
Other questions:
  • Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequ
    12·1 answer
  • URGENTEEE...
    6·1 answer
  • Polar bears are adapted to stay warm by growing thick fur.these organisms most likely live in a
    8·2 answers
  • ASAP Explain how heat in the atmosphere and water affect weather.
    15·1 answer
  • Which of the following have contributed to historical increases in the global human population? unavailability of clean water de
    13·2 answers
  • Which statement is least likely to support the endosymbiotic theory?
    8·1 answer
  • Sensory information is processed and relayed to the cerebrum by the
    11·1 answer
  • The description below is about a community in a poor country in need of certain basic
    5·2 answers
  • Select all that apply.
    15·2 answers
  • The DNA molecule is conformed by a sugar named: _______________, a ___________________ and a _______________ ______________ (___
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!