1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
natita [175]
4 years ago
8

Can someone answer these questions about clouds?

Biology
1 answer:
goldenfox [79]4 years ago
8 0
Different types of clouds indicate wether it’s going to snow, rain, hail, etc. Some clouds indicate if there’s going to be a storm.
You might be interested in
Heat energy is the transfer of _______ energy. A. chemical B. thermal C. electrical D. mechanical PLS HELP
9966 [12]
Mechanical I think I’m not sure sorry
3 0
3 years ago
Read 2 more answers
during mitosis and meiosis, DNA is duplicated, chromosomes separate, and cytoplasm divides. how are mitosis and meiosis differen
Misha Larkins [42]
Meiosis results in daughter chromosomes with only half of the original genetic information. mitosis creates a copy of the original cell
3 0
3 years ago
Which of the following are characteristics of
slega [8]

Answer:

b.Grow and change

c.Have a complex chemistry

d.Maintain homeostasis​

Explanation:

5 0
3 years ago
Read 2 more answers
Increase of greenhouse gases, due to human activity, is melting sea ice at the poles. This causes changes in climate. Name three
Zina [86]
Cryosphere, all Ice on earth, the gases melt the ice. Hydrosphere, once ice melts it turns into water. biosphere, lack of ice mean lack of habitat for some animal, penguins, polar bears etc. 
8 0
3 years ago
20. If a humidifier were used to increase the
AVprozaik [17]

Answer: D.600 minutes

Explanation:At 70 percent it takes about 450 minutes, so it should take about 600 minutes at 90 percent.

7 0
4 years ago
Other questions:
  • In the anabolic pathway for proteins, how is excessive protein stored?
    8·1 answer
  • Column C: What is the source of the organism’s energy? What does it eat? (There could be many, but just list one or two.)
    7·1 answer
  • True or false: intensity and duration of exercise directly affects blood-glucose levels, possibly leading to hypoglycemia.
    9·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • How can a geological time scale BEST be reconstructed?
    10·2 answers
  • Which of the following is NOT a phenotypic test?
    12·1 answer
  • Both E. coli and Salmonella are single-celled organisms. They do not have a nucleus or other membrane-bound organelles. Based on
    12·2 answers
  • Which of the following pressure graphs matches the simulation snapshot shown below
    5·1 answer
  • Why the study biology ​
    15·1 answer
  • Does anyone how to do this on legends of learning
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!