1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nookie1986 [14]
3 years ago
5

Anyone want to help me plz

Biology
1 answer:
Fynjy0 [20]3 years ago
5 0

Answer:

O horizon

it is most important for growth of crops

hope it helps

You might be interested in
"if a bacterium cannot use citrate, what result will occur in citrate agar?"
Annette [7]

If a bacterium cannot use citrate agar will not change its color (stays green). On the other hand, if bacteria have the ability to use citrate, the medium will change its color from green to blue.

This happens because citrate agar contains pH indicator such as bromothymol blue which transforms from green to blue in alkaline conditions.


3 0
3 years ago
Read 2 more answers
Potential results from changes in global phytoplankton populations are?
Dmitry [639]

Answer:

Declining populations of phytoplankton, the basis of the marine food chain, will alter the seawater hues, potentially decimating fisheries. The world's oceans are warming and growing more acidic as a result of climate change, and a provocative new study suggests they'll be changing color too.

Explanation:

Hope this is good :)

8 0
3 years ago
1.4.2 Test (CST): Computer-Scored Unit Test
trapecia [35]
A. The data did not support the hypothesis because more people preferred tap water.
3 0
2 years ago
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
The rungs of the DNA ladder are made from
coldgirl [10]

The "rungs" of the DNA strand are made up of nitrogenous bases.

8 0
3 years ago
Other questions:
  • One disadvantage that longer, more colorful tails have for peacocks.
    7·1 answer
  • The conchae __________.
    12·1 answer
  • What is the next step in the scientific method, following stating a question?
    9·1 answer
  • Review the following statements regarding training and glycogen and select the one that properly reflects the relationship betwe
    15·1 answer
  • What caused the Kingdom of Life to change? Give 3 reasons minimum.​
    13·1 answer
  • Development typically occurs in a ___________ pattern; however the OTA understands the influence of dynamic systems, including i
    9·1 answer
  • What happens to the water in a poolon a hot,sunny day ?​
    7·1 answer
  • A plant has a desirable trait: it is disease resistant. What can be done to quickly produce large numbers of identical plants wi
    12·1 answer
  • Which gas is being used from the atmosphere during photosynthesis?
    9·2 answers
  • Can DNA replicate if there are no nucleotides of one base!
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!