2 years ago

B-cells and T-cells fight off the threat by producing _______. ............................

1 answer:

6 0

B-cells fight bacteria and viruses by making Y-shaped proteins called antibodies, which are specific to each pathogen and are able to lock onto the surface of an invading cell and mark it for destruction by other immune cells

You might be interested in

1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0

3 years ago

BRAINLIESTTT ASAP!!!

Gnom [1K]

I'm pretty sure because, chemicals and pesticides can easily make insects more immune. So therefore the average pesticides will no longer work on them but also some may not be affected by the solutions.

6 0

3 years ago

Read 2 more answers

11) Any abiotic or biotic factor in an ecosystem that causes a population’s size to slow or decrease is a ____________ factor. A

Elden [556K]

The answer is B) limiting, would you like an explanation? <span />

4 0

3 years ago

if you were able to create a planet capable of supporting life forms similar to those on earth, the necessary elements to includ

Paraphin [41]

Oxygen, water, some type of resources to build, and food to eat

7 0

3 years ago

What boundary, the shearing forces of rock and create a what fault which moves

trasher [3.6K]

Answer:

Transform boundary

Explanation:

strike-slip faults- Shearing creates strike-slip faults. Transform boundary. In a strike-slip fault, the rocks on either side of the fault slip past each sideways, with little up or down motion.

5 0

3 years ago