1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
elena-14-01-66 [18.8K]
3 years ago
11

A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes t

he following
sequence of bases in one strand of the DNA molecule.
AACCTGGCCATGGACCTTTATATAAACTAGGAT
The researcher wants to revise the model to show the transcription of DNA to form mRNA.
Which of these revisions to the model would be most useful for the researcher to include?
O
A Replace thymine (T) with uracil (U) in the DNA molecule.
B
Keep the two strands of the DNA molecule joined together.
C. Identify promoter and "stop" regions on the DNA molecule.
O
D. Divide the DNA molecule into pieces that are 40 to 50 bases long
Review progress
Question 36
of 40
Back
Next →
Biology
1 answer:
Delicious77 [7]3 years ago
4 0
Correct answer - Replace Thymine (T) with uracil (U) in the DNA molecule.

Why? - As the RNA polymerase continues down the strand of DNA, more nucleotides are added to the mRNA, thereby forming a progressively longer chain of nucleotides. This process is called elongation. DNA (top) includes thymine (red); in RNA (bottom), thymine is replaced with uracil (yellow).
You might be interested in
It does not take much energy to change the temperature of a volume of water. <br><br> True or false
valentina_108 [34]

False, i believe water has a very high heat capacity.

4 0
4 years ago
Read 2 more answers
18. What is the hanging wall?
Strike441 [17]
It’s a decorative work that is used to beautify a room or area surface
4 0
3 years ago
The diagram below represents some changes that took place in a bacterial population recently exposed to an antibiotic.Which stat
FrozenT [24]

About the question:

You will find the diagram used to answer the question in the attached files.

Answer:

D) Some of the bacterial population was resistant to this antibiotic.

Explanation:

The term resistance refers to an inheritable change in a population sensitivity, reflected through the consecutive failure of the chemical effects, correctly used to reach a desired effect on the target population.

The excessive use of antibiotics on the bacteria population leads to the fixation of new mutated genes -by natural selection-. The mutated genes make these cells even more resistant to the drug.

In the exposed example we have,

  • Day 1 ⇒ a big population of white bacteria and only one black cell, probably <em>carrying mutated genetic material</em>.

The population was treated with antibiotics.

  • Day 2 ⇒ there are fewer white bacteria and three black cells. This means that white bacteria are dying, while the black ones are reproducing.

The mutated phenotype gets to survive under the effects of the chemical.

  • Day 3 ⇒ There are no more white bacteria. Only the black population survived and keeps reproducing.

The mutated bacteria reproduce with the capability of tolerating the antibiotic dose that is usually used to destroy a population of white bacteria.

  • Day 4 ⇒ Black bacteria got to survive a produce a big population. Remember that <em>bacteria follow the exponential growth model, </em>meaning that their reproductive rate is too high. This black population survived the antibiotic action and reproduced at high rates.

6 0
3 years ago
Name two vestigial structures.
ycow [4]
Two vestigial structures is wisdom teeth and the tail bone.
Hope it helps
4 0
3 years ago
The earths is a thin layer of rock that surrounds the earth
Nataly_w [17]

Answer: Atmosphere

Explanation: <u>Our planet is surrounded by a layer of gases called the atmosphere</u>. Without our atmosphere, there would be no life on earth.

5 0
3 years ago
Other questions:
  • Describe one difference between PCR and recombinant DNA technology
    5·2 answers
  • The sac inside a plant cell where water wastes and food are stored is called
    5·1 answer
  • If the decolorizer is left on too long in the Gram-staining procedure, gram-positive organisms will be stained __________ and gr
    12·1 answer
  • Consider the diagram of a eukaryote and a prokaryote. According to cell theory,
    10·2 answers
  • Can someone please help
    11·1 answer
  • In the above animal cell, what is the function of the cellular organelle labeled with the letter Z? A. contains the cellular DNA
    12·2 answers
  • Pls, help me today with my quiz!
    5·2 answers
  • _________________ results in the formation of two new cells.
    13·2 answers
  • A region of the earth's surface with a specific climate where only certain types of plants and animals live.
    7·1 answer
  • What will be the pulse rate if you meet a black bear in the forest
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!