1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
elena-14-01-66 [18.8K]
3 years ago
11

A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes t

he following
sequence of bases in one strand of the DNA molecule.
AACCTGGCCATGGACCTTTATATAAACTAGGAT
The researcher wants to revise the model to show the transcription of DNA to form mRNA.
Which of these revisions to the model would be most useful for the researcher to include?
O
A Replace thymine (T) with uracil (U) in the DNA molecule.
B
Keep the two strands of the DNA molecule joined together.
C. Identify promoter and "stop" regions on the DNA molecule.
O
D. Divide the DNA molecule into pieces that are 40 to 50 bases long
Review progress
Question 36
of 40
Back
Next →
Biology
1 answer:
Delicious77 [7]3 years ago
4 0
Correct answer - Replace Thymine (T) with uracil (U) in the DNA molecule.

Why? - As the RNA polymerase continues down the strand of DNA, more nucleotides are added to the mRNA, thereby forming a progressively longer chain of nucleotides. This process is called elongation. DNA (top) includes thymine (red); in RNA (bottom), thymine is replaced with uracil (yellow).
You might be interested in
Please help I need tie right answer
Zinaida [17]
C is the best answer
8 0
3 years ago
Can the temperature of land affect the temperature of air as the air moves over the land?
maksim [4K]

Answer:

A

Explanation:

Land is warmer then air

8 0
3 years ago
Read 2 more answers
What is the most abundant compound in living things?
sergij07 [2.7K]

Answer: water

Explanation: Water is everywhere and required to survive, so water would be the most abundant compound.

4 0
3 years ago
Which mutations is most likely to cause a phenotypic change?
melomori [17]

The question is incomplete. The complete question is as follows:

Which of the following mutations is most likely to cause a phenotypic change?

A) a duplication of all or most introns

B) a large inversion whose ends are each in intergenic regions

C) a nucleotide substitution in an exon coding for a transmembrane domain

D) a single nucleotide deletion in an exon coding for an active site

E) a frameshift mutation one codon away from the 3' end of the nontemplate strand

Answer: D) a single nucleotide deletion in an exon coding for an active site

Explanation:

Deletion or insertion of a single nucleotide in an axon coding for an active site is called frameshift mutation.

The sequence of codons is read during translation, in order to synthesize a amino acids chain and form a protein from the nucleotide sequence. Frameshift mutations occur when the usual codon sequence is broken by the deletion or addition of one or more nucleotides. For example, if only one nucleotide is removed from the axon sequence during the RNA splicing process, then there will be a disrupted reading frame for all codons before and after the mutation. This may result in several incorrect amino acids being introduced into the protein. Disruption in protein sequence will cause phenotypic change.

Hence, the correct option is D) a single nucleotide deletion in an exon coding for an active site .

5 0
3 years ago
What are the five functions of the skeleton system
Ann [662]
Protection- the cranium and ribs protect the brain and vital organs in the chest

Shape- gives shape to the body and makes you tall or short

Support- holds your vital organs in place when playing sports. The vertebrae column holds the body upright

Movement- muscles are attached to bones, which are joined. When the muscles contract, the bones move

Blood Production- red blood cells(to carry oxygen) and white blood cells(to protect against infection) are produced in the bone marrow of some bones
4 0
3 years ago
Other questions:
  • 4. An animal that relies on a digestive tract for digestion breaks down food bya. both intracellular and extracellular digestion
    8·1 answer
  • What might happen if the testes were located inside the body?
    15·1 answer
  • Could a person with type o blood have a child with type ab blood? explain why or why not.
    9·1 answer
  • What moves the food from your mouth to your stomach when you swallow? undulatory muscle contractions pressure difference between
    5·2 answers
  • A substance forms when positively charged particles and negatively charged particles attract each other the substance is ?
    11·1 answer
  • what is the final pH of a solution made by mixing 100 ml of 0.05M acetic acid and 100 ml of 0.1M sodium acetic? assuming pKa for
    8·1 answer
  • Which of the following is the best definition of fermentation?
    14·1 answer
  • We will soon exceed earth’s carrying capacity
    14·2 answers
  • What traits do you think future generations of humans would have and what behaviors would they exhibit? Write a claim-evidence-r
    11·1 answer
  • Interstitial fluid is located in the _______. interstitial fluid is located in the _______.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!