1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
elena-14-01-66 [18.8K]
3 years ago
11

A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes t

he following
sequence of bases in one strand of the DNA molecule.
AACCTGGCCATGGACCTTTATATAAACTAGGAT
The researcher wants to revise the model to show the transcription of DNA to form mRNA.
Which of these revisions to the model would be most useful for the researcher to include?
O
A Replace thymine (T) with uracil (U) in the DNA molecule.
B
Keep the two strands of the DNA molecule joined together.
C. Identify promoter and "stop" regions on the DNA molecule.
O
D. Divide the DNA molecule into pieces that are 40 to 50 bases long
Review progress
Question 36
of 40
Back
Next →
Biology
1 answer:
Delicious77 [7]3 years ago
4 0
Correct answer - Replace Thymine (T) with uracil (U) in the DNA molecule.

Why? - As the RNA polymerase continues down the strand of DNA, more nucleotides are added to the mRNA, thereby forming a progressively longer chain of nucleotides. This process is called elongation. DNA (top) includes thymine (red); in RNA (bottom), thymine is replaced with uracil (yellow).
You might be interested in
Which property of the nitrogen cycle makes it a good illustration of the conservation of matter
sdas [7]
<span>The Law of Conservation of Matter states that matter cannot be created or destroyed; it is simply changed. The carbon goes through different things (it cycles through) and it goes through changes, but it does not get destroyed.

</span>
7 0
3 years ago
Read 2 more answers
Organisms that eat only meat are called Producers Herbivores Carnivores Omnivores
777dan777 [17]
An animal that only eats meat is called a carnivore
An animal that eats both meat and vegetation is called an omnivore
An animal that only eats vegetation is called a herbivore

6 0
4 years ago
Read 2 more answers
Dylan has two cubes of iron. The larger cube has twice the mass of the smaller cube. He measures the smaller cube. Its mass is 2
Shtirlitz [24]
Density={ \frac {Mass}{Volume} } \\ \\ Volume={ \frac{Mass}{Density} } \\ \\ Volume={ \frac{20g+20g}{7.87g/cm^3} } \\ \\ Volume=5.08\ cm^3 \\ \\ \\ \\ Volume\ of\ larger\ cube=5.08\ cm^3
8 0
4 years ago
From about 4 billion years ago to about 2.5 billion years ago, oxygen gas became more common in Earth's atmosphere. Oxygen was a
Papessa [141]

Answer:

Over time, many species gradually adapted to a more oxygen-rich enviroment, allowing them to survive in shallow water and on land.

6 0
3 years ago
1. What evidence supports the notion that sponges are some of the earliest known multicellular animals?
Serga [27]

<u>Answer:</u> "Chemical fossils"evidence supports the notion that sponges are some of the earliest known multicellular animals.

<u>Explanation:</u>

Sponges are multicellular animals, may belong to Ediacarian period likely to be 80 million years ago or earlier. They catered through a complex system of internal channels, by moving seawater.

Sponges are soft-bodied and very rarely protected as fossils, therefore finding evidence of existence is giant task. The key of their existence came to know from abnormal chemicals which is a steroids of a particular type generated sufficiently by them but virtually never by ordinary organisms.

Analysis of long strata sequence found in Oman and researchers have been able to extract these "chemical fossils" from samples spanning tens of millions of years — before, during and after the Ediacarian period.This gave clear evidence that sponges had to have evolved long before the great variety of multicellular organisms proliferated at the dawn of that time.

8 0
3 years ago
Other questions:
  • Elect the correct responses to the questions from the drop-down menus.
    8·2 answers
  • If you ever swam in a pool and your eyes began to sting and turn red, you felt the effects of an incorrect pH level. pH measures
    8·1 answer
  • Seedless, vascular plants are most commonly found in which type of climate
    12·2 answers
  • Explain why there would be more errors in dna replication if thymine was sometimes able to form bonds with cytosine. PLEASE HELP
    11·1 answer
  • What do you think might happen if temperatures rise much higher than 30 degree celsius
    11·1 answer
  • 1)What is an enzyme?
    8·1 answer
  • Drag the steps into the correct order to show how plants use energy from the sun. Start with the first step on top.
    14·1 answer
  • Whoever writes the best report on why humans should explore space will get brainliest
    13·1 answer
  • How many atoms does Ga 2(Cr2O7)3
    10·1 answer
  • Describe How water is tested for color in platinum cobalt method​
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!