A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes t
he following sequence of bases in one strand of the DNA molecule.
AACCTGGCCATGGACCTTTATATAAACTAGGAT
The researcher wants to revise the model to show the transcription of DNA to form mRNA.
Which of these revisions to the model would be most useful for the researcher to include?
O
A Replace thymine (T) with uracil (U) in the DNA molecule.
B
Keep the two strands of the DNA molecule joined together.
C. Identify promoter and "stop" regions on the DNA molecule.
O
D. Divide the DNA molecule into pieces that are 40 to 50 bases long
Review progress
Question 36
of 40
Back
Next →
Correct answer - Replace Thymine (T) with uracil (U) in the DNA molecule.
Why? - As the RNA polymerase continues down the strand of DNA, more nucleotides are added to the mRNA, thereby forming a progressively longer chain of nucleotides. This process is called elongation. DNA (top) includes thymine (red); in RNA (bottom), thymine is replaced with uracil (yellow).
