1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alexus [3.1K]
3 years ago
7

Where does seafloor spreading occur?

Biology
2 answers:
Thepotemich [5.8K]3 years ago
6 0

Answer:

Seafloor spreading occurs along mid-ocean ridges—large mountain ranges rising from the ocean floor. The Mid-Atlantic Ridge, for instance, separates the North American plate from the Eurasian plate, and the South American plate from the African plate.

Explanation:

ivanzaharov [21]3 years ago
5 0
Sea floor spreading occurs along mid-ocean ridges, and large mountain ranges rising from the ocean floor.
You might be interested in
ASAP PLEASE HURRY AND HELP!!!
Bezzdna [24]

Answer:

d clouds

Explanation:

its sucks up water

7 0
3 years ago
Read 2 more answers
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
4 years ago
What is the role of plastic in your life? And why is it important to think about the role of plastic in your life?
Phoenix [80]
Plastics clearly constitute an important component of the range of materials used in modern society. Almost all aspects of daily life involve plastics or rubber in some form or the other. ... Owing to their light weight, plastics reduce transportation costs and, therefore, atmospheric carbon dioxide emissions./Plastic is durable and provides protection from contaminants and the elements.
5 0
3 years ago
Hailstones do a lot of damage when they fall to the Earth and hit homes and cars with great force they hit was great force becau
monitta

They accelerate as they fall to Earth

6 0
3 years ago
Read 2 more answers
Alcohol acts as a diuretic because it ________.
Anastasy [175]
Alcohol acts as a diuretic because it inhibits the release of ADH.
7 0
3 years ago
Other questions:
  • Your family owns a bakery and has kept the same "family recipe" for bread for over 50
    5·1 answer
  • An unresponsive state from which a person can be aroused only briefly despite vigorous, repeated attempts is known as a _______.
    7·1 answer
  • 2 Paragraph summery on how Anna Garcia died
    7·2 answers
  • In angiosperms, a zygote and endosperm form as a result of
    10·1 answer
  • The gradual change and buildup of organisms in an environment
    11·2 answers
  • "Which of the following statements are true?
    15·2 answers
  • How did the railroad help change the prairie?
    14·1 answer
  • Imagine you do a test cross between a purple-flowered pea plant having serrated leaves (a dominant trait) and a white-flowered p
    11·1 answer
  • Give an example of a dry climate.
    11·1 answer
  • What molecule enters the citric acid cycle and combines with oxaloacetate to form citric acid?.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!