1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
rjkz [21]
3 years ago
13

Stuart is studying weather data for his region. The data was gathered from 1950 to 2016. Which observation would

Biology
1 answer:
Lorico [155]3 years ago
4 0

the first one provides the most evidence

You might be interested in
Exchange of chromosome segments between homologous chromosomes during Meiosis 1
svetlana [45]
Answer:
C. Genetic Exchange

4 0
3 years ago
HELP ASAP!!! WILL MARK BRAINLIEST!!!
pickupchik [31]

The answer would be B.

The new species will start competing for all of the necessities that everything else needs to survive resulting in everything else reducing in population size.

Hope this could help,

Trey

7 0
3 years ago
Amelia puts some ice cubes in a cup of water at room temperature. Which statement describes the heat flow in this situation?
Alex777 [14]

Answer:

D sounds most likely hfjdjs

5 0
3 years ago
Read 2 more answers
Lauren has cystic fibrosis. Her body is unable to control the flow of salt into and out of her cells. Lauren's symptoms include
KIM [24]

Answer:

Cell membrane

Explanation:

According to the question, Lauren's diseased condition, which is cystic fibrosis, is characterized by her body's inability to control the flow of salt into and out of her cells leading to symptoms include coughing and wheezing when she tries to exercise.

Lauren's inability to control the movement of salt and water into her cells is as a result of an affected CELL MEMBRANE. The cell membrane is the organelle that controls what goes in and out of a cell due to its semi-permeability.

6 0
3 years ago
Read 2 more answers
Especially with bacteria and fungi, the most common manifestation of growth on solid media is the appearance of
gladu [14]

The most common manifestations of growth of bacteria and fungi on solid media is the appearance of surface texture, transparency, and the color.

<h3>Bacteria and fungi culture</h3>

Bacterial and fungus culture is a method that allows the multiplication of bacterial and fungi cells in or on a culture medium under controlled laboratory conditions.

Learn more about culturing bacteria and fungi:

brainly.com/question/17434674

6 0
2 years ago
Other questions:
  • 1. What are the biotic factors of an ecosystem?
    12·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Which of the following is true about the DNA molecule during transcription?
    6·1 answer
  • Need help with 2c. Describe what would happen over time to a tree sapling that could grow only taller not wider.
    9·1 answer
  • If a new body of evidence were found that directly contradicted the cell theory, groups of scientists would then _________ ?
    11·2 answers
  • This is due at 11:59 please helpppppoo
    7·1 answer
  • Which statements describe a bacteriophage? Select all that Apply.
    8·2 answers
  • Match the following characteristics to the appropriate ecosystems.
    11·1 answer
  • Will a mutation in a human skin cell be passed on to the person's offspring?
    15·1 answer
  • Hurry help!
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!