1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dangina [55]
3 years ago
14

As you observe an unknown cell under a microscope, you make the following observations. Need help ASAP. Thanks!

Biology
1 answer:
Komok [63]3 years ago
4 0

Answer:

<h2>Plant cell</h2>

<h3>Hope it helps you </h3>

You might be interested in
What is a Parent cell? What is a Daughter cell?
valentinak56 [21]

Answer:

momy lomimPamaj uwiwiq

4 0
3 years ago
Read 2 more answers
Does anyone know what the 4.06 module exam password and science is? I’m too scared to ask my teacher :-(
zzz [600]
This app is used world wide , maybe try asking a classmate
5 0
3 years ago
By computing the present value of the principal paid at maturity and all interest payments to be made over the term of the bond,
solong [7]
By computing the present value of the principal paid at maturity and all interest payments to be made over the term of the bond, you can obtain the market price of bonds. Thank you for posting your question here at brainly. I hope the answer will help you. Feel free to ask more questions here.
3 0
3 years ago
Read 2 more answers
Help I’ll mark u brainless
marishachu [46]

Answer:

The answer is A

Explanation:

It is A because rock, water, and sand are all abiotic , is is NOT c because algae is a biotic factor

8 0
3 years ago
It is actually the 16S rRNA component of a 30S ribosomal subunit that is responsible for recognition of a Shine-Dalgarno sequenc
Diano4ka-milaya [45]
<h2>The correct answer is (D)</h2>

Explanation:

  • The Australian scientists John Shine and Lynn Dalgarno proposed the Shine Dalgarno Sequence.
  • The Shine Dalgarno Sequence is found around 8 Bases in upstream of AUG which is a start codon.
  • In archaea mRNA and bacteria Shine Dalgarno Sequence is a ribosomal binding site.
  • The Shine Dalagarno Sequence is found in archaea and bacteria.
  • It is also seen in Mitochondrial transcripts and Chloroplast.

4 0
4 years ago
Other questions:
  • What is apical meristematic tissue? And its function
    11·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Use the graph below to answer the following question: What is happening to the object's velocity
    5·1 answer
  • A group of biologists would like to recreate suitable habitats for wildlife in a particular area. They would also like to help f
    13·2 answers
  • Cellular respiration can best be described as Group of answer choices using energy released from breaking high-energy covalent b
    6·2 answers
  • Explain how a government is able to slow down or speed up the economy's rate of growth.<br>​
    9·1 answer
  • Which characteristic of life best describes the process of photosynthesis?<br>​
    9·1 answer
  • ILL MARK YOU BRAINLIEST If each of the organisms in the chart is placed in a saline solution of 1% salt concentration, which org
    13·1 answer
  • Yardangs are tall, broad peaks that appear in deserts. Weathering and erosion work together to form yardangs. They are produced
    5·2 answers
  • Use the drop-down menus to complete each sentence.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!