1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ludmilka [50]
3 years ago
14

. The value of Maggie's car decreased by 10% since last year, when she bought it. If the car is now worth $15,000.00, how much w

as the car worth when she bought it?
Biology
1 answer:
Phoenix [80]3 years ago
7 0
You multiply 15,000 by .1, which equals 1,500. Then you add that to 15,000. This equals 16,500. That is your answer.
You might be interested in
In John Watson's Little Albert experiment, the white rat was the ________ and the loud noise was the ________.
Korolek [52]

Answer:

In John Watson's Little Albert experiment, the white rat was stimulus associated specific entity and the loud noise was the associated stimulus.

7 0
3 years ago
Hemophilia is a condition in which blood does not clot naturally, and a person with hemophilia could bleed to death if injured.
barxatty [35]

As we know our blood has four main components which are plasma, red blood cells, white blood cells and platelets. That is why a hemophiliac must receive regular injections of platelets to stay alive. This is done by injecting into their bloodstream human plasma which contains many proteins, glucose, clotting factors, electrolytes, hormones, and carbon dioxide.


<span>I hope it helps, Regards.</span>

5 0
2 years ago
Read 2 more answers
30. Why can mitochondria be considered the power plants of the aerobic cells?
Svetach [21]
Mitochondria produce ATP, energy that is vital in aerobic cells. Therefore, I believe this is why they can be considered as power plants.
8 0
3 years ago
What is the last step of a scientific investigation?
aleksandr82 [10.1K]

Answer:

its c

Explanation:

communicating the result is significant to analyzing data

4 0
2 years ago
Read 2 more answers
Bacteria can be used to clean up toxic waste? True or false
Lunna [17]

Answer:

true

Explanation:

3 0
2 years ago
Read 2 more answers
Other questions:
  • One student uses a flat toothpick as a mining equipment in a cookie mining lab. In your own words, explain how changing mining t
    7·1 answer
  • Which of the following organisms exhibits radial symmetry?
    8·2 answers
  • What is the substance that is made up of dna and protein tightly packed together?
    11·1 answer
  • Medical management of cardiac failure uses similar methodology whether it is right-sided or left-sided. measures such as dietary
    12·1 answer
  • How do organisms use flagella to cause movement?
    13·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Why do scientists share the results of experiments?
    14·2 answers
  • Free brainllest again!!!
    11·2 answers
  • M protein is produced by
    8·1 answer
  • What is the main factor that causes the bedrock to weather at different rates?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!