<span>There is so misinformation about staying away from carbohydrates. What Jack should realize is that everyone needs a balance of fats, about 20% of your calories, proteins, about 0.5 to 1.0 gram per body weight, then using a total calorie estimation, figure how many calories should come from carbohydrates. They really are important for energy.</span>
The answer would be A. thick filaments!
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Answer:
Due to lack of nutrients in the soil.
Explanation:
Within a few years the forest was dying because there is no nutrient is present in the soil which can trigger the growth and development of the sol. The fallen parts of trees such as branches, tree and leaves etc are decomposed by decomposers such as bacteria and fungi which turn the fallen materials into nitrogenous materials which can be used by the plant for its growth and development.
