1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frutty [35]
3 years ago
6

If a cat meows in the woods, does a dog cringe?!

Biology
2 answers:
Likurg_2 [28]3 years ago
7 0

Answer:

ofc

Explanation:

Pani-rosa [81]3 years ago
4 0

Answer:

I mean maybe....

Explanation:

You might be interested in
A male patient presents with the following respiratory volumes and capacities : tv= 500 ml ; erv=1200 what is the patients vc.?
Sedaia [141]
The correct formula for solving this question is: VC = IRV + ERV + TV, where VC is vital capacity, IRV is inspiratory reserve volume, ERV is expiratory reserve volume and TV is tidal volume. From the given information, TV =500, ERV =1200 and the standard IRV for male is 3100ml, therefore,
VC=  3100 + 1200 + 500 = 4800ml.
3 0
3 years ago
Read 2 more answers
Place the following events from the Civil War in the correct order with the numbers in the drop down
Over [174]

Answer:

lee surrendered (3)

Lincoln assassinated (4)

Union forces captured Richmond (2)

Sherman made March to the Sea  (1)

Explanation: i just did it

7 0
4 years ago
Read 2 more answers
How many recessive genes does a individual need in order to show the recessive trait?
aleksandrvk [35]
Both genes need to be recessive in order for a recessive trait to be expressed.

I hope this helps!
4 0
3 years ago
Read 2 more answers
Which of the following statements is true about mutations?
Blababa [14]

Answer:

A. It is a source of genetic variation

7 0
3 years ago
Read 2 more answers
During contraction what happens to zones of overlap
ICE Princess25 [194]
A zone stays the same length, I zone and h zone get shorter
8 0
3 years ago
Other questions:
  • The ratio of body weight to height is represented as
    12·1 answer
  • Prior to phytoremediation the concentration of Cd in the soil was: Prior to phytoremediation the concentration of Cd in the soil
    6·1 answer
  • Why are organisms classified
    7·2 answers
  • he chart below shows the three main types of plant tissues and associated tissues. The chart shows the 3 main types of plant tis
    9·2 answers
  • Organisms maintain dynamic homeostasis through behavioral and physiological mechanisms. in your own words, give an accurate expl
    12·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Question 3 of 10
    10·1 answer
  • How Do You "Win" At Natural Selection?
    14·1 answer
  • The Earth has a magnetic field. If you were to use a bar magnet to represent the magnet causing the magnetic field, which repres
    14·2 answers
  • Mia has four aquatic plants of same size and species.She submerges each plant in a separate filled with 200 ml of water. She the
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!