1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Len [333]
3 years ago
9

Look at the pictures of the animals in Table 1.1 and

Biology
1 answer:
vekshin13 years ago
7 0
1. Frog 2. Alligator 3. Shark
You might be interested in
A segment of mRNA has the sequence ugacauagc which of the following would represent the tRNA anticodons for this mRNA
kotykmax [81]

Answer: Plant because they survive by water and sunlight.

Explanation:

5 0
3 years ago
Effects of the energy source
oee [108]
Do you have a question here?
6 0
4 years ago
Read 2 more answers
The scientific method is cyclic/linear
mestny [16]

Answer: The scientific method is cyclic.

Explanation: Scientific methods is the systematic way of using knowledge , hypothesis , observation , theories and experiments , to give us understanding for the questions.

Scientific method is always cyclic as it involves several steps. Cyclic way give us better understanding about facts and whole phenomena.

4 0
4 years ago
Read 2 more answers
Which trait distinguishes between the kingdoms of Bacteria and Archaea? A. whether or not the organisms thrive in extreme condit
adell [148]

Answer:. whether or not the organisms thrive in extreme conditions

Explanation: i took the class

3 0
3 years ago
2 What is occurring during the flow phase of the menstral cycle?
Montano1993 [528]

Answer:

Explanation:

Tissues are shed from the endometrium

7 0
3 years ago
Other questions:
  • Which cell structure serves the state of function in both eukaryotic and prokaryotic cells?
    14·1 answer
  • Jeanie was playing croquet. The picture below shows her holding her wooden mallet. Jeanie swung her mallet hard and hit her ball
    11·1 answer
  • That the allele that gives human red blood cells increased resistance to malarial parasites also reduces the amount of oxygen th
    9·1 answer
  • During which period did the first land vertebrates appear?
    12·1 answer
  • What is the removal of a short section of stem called?
    11·1 answer
  • What is the complementary DNA of TACCGGATGCCAGATCAAATC?
    10·1 answer
  • What does DNA replication mean?​<br><br>thankyou ~
    10·2 answers
  • Help Match The Following Terms!
    12·1 answer
  • What are the three parts of the modern cell theory?
    6·2 answers
  • the organic compound that contains the elements carbon, hydrogen and oxygen and where the ratio of hydrogen to oxygen is 2:1.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!