1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Naddika [18.5K]
3 years ago
11

Caleb counts the number of waves that pass a given point in a certain amount of time on the beach. What property of waves does C

aleb measure?
Question 6 options:

period


frequency


amplitude


wavelength


The types of waves: mechanical and electromagnetic. Microwaves, Infrared waves, and radio waves are examples of electromagnetic waves. Which statement is true about the speed of an electromagnetic wave?

Question 7 options:

It is not affected by changes in media.


It is slower in a vacuum than in a medium.


In a vacuum, its speed equals half the speed of light.


It slows down when it goes from a vacuum to a medium

Properties of waves can be applied to other situations. Suppose a cafeteria worker counts the number of students going through the lunch line every hour. What property, which can also be measured for a wave, is he measuring?

Question 9 options:

period


frequency


amplitude


wavelength


Our eyes detect light that lies only within a small region of the electromagnetic spectrum. This region is called visible light. Which of these statements describes the visible spectrum of light as seen by the human eye?

Question 10 options:

The lowest frequency appears red, and the highest frequency appears Violet.


The lowest frequency appears green, and the highest frequency of hair is red.


The lowest frequency appears blue, the highest frequency appears orange.


The lowest frequency appears yellow, and the highest frequency appears green.

What is one way that electromagnetic waves differ from mechanical waves?

Question 11 options:

Electromagnetic waves move slower.


Electromagnetic waves are longitudinal.


Electromagnetic waves can travel through empty space.


There is no difference between them.


How does the sun transfer energy to Earth?

Question 12 options:

By making earth spin


By mechanical waves


By electromagnetic waves


By the Earth revolving around the Sun


Sunlight is composed of energy that is visible to humans and energy that is not visible to humans. Which statement describes how the visible energy from the Sun is different from nonvisible energy?

Question 13 options:

It travels at a different speed.


It travels at a different distance.


It has different wavelengths.


It has different amplitudes.

PLEASE HELP ME :(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((
Biology
1 answer:
AnnZ [28]3 years ago
8 0
Wave length amplitude frequency period
You might be interested in
Which of the following statements is true?
gogolik [260]
The statement that is true is B. <span>Dissolved minerals from rocks are deposited in the ocean. All of the other statements are not correct, they are false.</span>
7 0
3 years ago
Read 2 more answers
Where are the reproductive parts of an angiosperm located?
kodGreya [7K]
The reproductive parts of an angiosperm are located in the flowers. A flower of an angiosperm usually consists of four whorls namely calyx, corolla, androecium and gynoecium.
3 0
3 years ago
Read 2 more answers
Which scenario is an example of a functional adaptation?
muminat

Answer:

Here you go bud A functional adaption is an adaption that helps an organism survive. So, the color and shape of a flounder allows it to camouflage itself among the sea floor to hide itself from predators. Flounders ability to camouflage protects them, so they can survive Hope this helps good luck

8 0
3 years ago
Read 2 more answers
In 1951, four scientists were working on solving the structural puzzle of the DNA molecule. Two of those
joja [24]

Answer:

I think its James Watson and Francis Crick

Explanation:

4 0
3 years ago
Read 2 more answers
3. Through the enteric nervous system, stress causes:
Nat2105 [25]

Answer:

This will help you

Explanation:

In more serious cases, stress may cause a decrease in blood flow and oxygen to the stomach, which could lead to cramping, inflammation, or an imbalance of gut bacteria. It can also exacerbate gastrointestinal disorders, including Irritable bowel syndrome (IBS) Inflammatory bowel disease (IBD)

5 0
3 years ago
Other questions:
  • What is true about valence electrons?
    8·2 answers
  • The electromagnetic waves with the shortest wavelengths and the highest frequencies are called
    11·2 answers
  • When the contents of a vesicle are released by the cell is called_____?
    15·2 answers
  • What should a following are examples of fossil fuels?
    13·1 answer
  • Which statement applies only to the axial skeleton, not the appendicular skeleton? A. It contains a pivot joint. B. It has muscl
    11·1 answer
  • How does an increased population size affect the amount of competition between organisms?
    8·1 answer
  • How should an unknown organism be classified
    11·2 answers
  • What four body plan innovations were found in an ancient flatworm
    9·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • The direction that an ocean current travels can be altered by the movement of the Earth's rotation on its axis. This is known as
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!