1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ryzh [129]
2 years ago
7

I need the answers quick

Biology
1 answer:
weeeeeb [17]2 years ago
3 0
I need options sorry
You might be interested in
In which of the following locations in region of Australia and New Zealand can one see the largest amounts of coral? Great Barri
sweet-ann [11.9K]
The Great Barrier Reef is one of the most sought-after scuba diving spots in the entire world, with phenomenal coral beds that are flooded with light and sea life.
5 0
3 years ago
Read 2 more answers
The removal of soil or sediment by wind and moving water or ice is called
GuDViN [60]

Hello!


Your answer would be erosion.


Erosion means to "move" sediments through wind, water, etc.

Weathering means to break down something.

Decomposition means to decay.


Hope this helps! Have a amazing day! ~Pooch ♥

3 0
2 years ago
Read 2 more answers
What is a mitochondrium?
Delvig [45]

The power house of the cell

only thing I remember from freshman year

8 0
3 years ago
Read 2 more answers
NAME all the steps of Photosynthesis. What is Produced in Each Step? What are the Reactants Used in each step? What is the Final
bonufazy [111]

Answer:

1.The light-dependent reactions;

The light-independent reactions, or Calvin Cycle

2.Cellular respiration is a metabolic pathway that breaks down glucose and produces ATP. The stages of cellular respiration include glycolysis, pyruvate oxidation, the citric acid or Krebs cycle, and oxidative phosphorylation.

3.In production, a final product, or finished product is a product that is ready for sale. For example, oil is the final product of an oil company. The farmer sells his vegetables as his final product, after they have been through the whole process of growth.

Explanation:

7 0
2 years ago
The push or pull of one object on another
Leni [432]
A force is a push or a pull. When one object pushes or pulls another object, you say that the first object is exerting a force on the second object.
3 0
3 years ago
Read 2 more answers
Other questions:
  • You are dispatched to an apartment complex where a 21-year-old female has apparently overdosed on several narcotic medications.
    12·1 answer
  • En la raza de ovejas Rommey Marsh, un gen conocido como gris letal, provoca que el feto gris GG, muera antes de las 15 semanas d
    5·1 answer
  • W?hjduudududhehehehud7djeb4hheurudhdhrjrj
    10·2 answers
  • The buildup of the products of nucleic acid metabolism can lead to
    15·1 answer
  • What would be considered a disadvantage?
    12·2 answers
  • Observe: On the SIMULATION pane, observe the directions of the velocity (green) and acceleration (purple) vectors. A.What do you
    13·1 answer
  • Why did other parts of the Megalodon never turn into fossils?
    10·2 answers
  • After sperm are produced, they move into a sperm storage area called the _____.
    10·2 answers
  • Waste in high income countries is made up of mostly
    8·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!