1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
il63 [147K]
3 years ago
6

If cells are placed in a strong sugar solution, water will ___.

Biology
2 answers:
8_murik_8 [283]3 years ago
7 0

Answer: Pass mostly from the cells to the sugar solution

Andreyy893 years ago
5 0

Answer:

Pass mostly from the cells to the sugar solution

Explanation:

I remember learning this in 6th grade! <3

You might be interested in
There is an enzyme that catalyzes the production of the pigment responsible for dark fur color in siamese cats and himalayan rab
MariettaO [177]

Answer:

Light brown colour will be appear.

Explanation:

If the rabbit raised at 20 c then the rabbit gain brown colour because the pigment which is responsible for the dark colour does not work due to increase in temperature. Enzymes are those substances which speedup the chemical reaction so when the temperature becomes higher, the enzyme did not function properly and the colour pigment gives light brown colour to the rabbit.

6 0
3 years ago
what sequence represents the correct order of events for production of the necessary complex molecules after food is taken in by
leonid [27]
Digestion, Absorption, Circulation, Diffusion, Synthesis. 

Digestion begins as soon as you put food in your mouth and begin chewing it, so it is the first step. Absorption happens when food is converted into substances that can be absorbed by your GI tract. Circulation is where those nutrients are circulated in your lymphatic and circulatory system (blood). Diffusion moves oxygen through your blood stream where it gets diffused. S<span>ynthesis converts nutrients that have been diffused and absorbed in your blood. </span>
5 0
3 years ago
The property that holds molecules of the same substance together is called cohesion true or false
Nata [24]
Your answer is true 

Hope this helps <3
4 0
3 years ago
You are caught in severe weather while boating. what should you do?
Neko [114]
You should try to go back to land and find a cover and make a little shelter and go under it then wait it out.
5 0
3 years ago
What blood cholesterol carrier is of greatest concern in atherosclerosis? hdl vldl ldl?
blondinia [14]
The answer is LDL (Low Density Lipoprotein)

Arteriosclerosis is the build up of cholesrol on the inner walls of the arteries. In the long run, arteriosclerosis reduces the diameter of the blood vessels, causing high blood pressure. 
The endothelial cells of arteries have receptors that facilitate binding and transportation of the LDL hence facilitation of their accumulation in the blood vessels.
8 0
4 years ago
Other questions:
  • 8. Which of the following type of colors gives a sense of
    5·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • Hummingbirds are pollinators.
    13·2 answers
  • The code for heredity is carried on <br><br> in each organism's DNA.
    11·1 answer
  • The process in which a solid changes to a liquid is called
    9·2 answers
  • E. coli cells grown on 15N medium are transferred to 14N medium and allowed to grow for two more generations (two rounds of DNA
    15·1 answer
  • Which best explains why water is able to “stick” to the side of glass? Strong adhesive forces exist between different water mole
    10·1 answer
  • Does a prokaryotic cell or a eukaryotic cell seem more simple? Explain our answer.​
    8·1 answer
  • Is this karyotype from a male or female? how do you know ?<br> Also do they have down syndrome? How?
    10·1 answer
  • Based only on the graph, it is obvious that Locations A and B are both in the Southern Hemisphere. Why?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!