1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dimulka [17.4K]
3 years ago
10

Why do sex-linked traits follow different patterns of inheritance than other traits?

Biology
2 answers:
poizon [28]3 years ago
8 0

Answer: C

Males have two X chromosomes, and females only have one.

Maurinko [17]3 years ago
4 0

Answer:

MALES ONLY HAVE ONE X CHROMOSOME

Explanation:

You might be interested in
Organelles are structures within the cell that perform important functions. Which of the following correctly matches the
Firdavs [7]

Answer:

mitochondria: <u>powerhouse of the cell</u>

Ribosomes<u>: the places where proteins are synthesized in our cells. </u>

nucleus <u>houses DNA;controls cell</u>

Vacuole: <u>holds waste and fluids from cell</u>

Ribosomes: <u>tiny organelles that contain RNA and specific proteins within the cytoplasm. </u>

Explanation:

Organelles make up the subunits of a cell.  There are numerous each with their own function.  

3 0
2 years ago
How have increased carbon dioxide levels and temperatures affected living organisms?
d1i1m1o1n [39]

Answer:  

Carbon dioxide is a gas which is released in the atmosphere as greenhouse gas, burning of fossil fuel, released in respiration process. Rise in the levels of carbon dioxide and other gases has resulted in increase in global temperatures. Increase in carbon dioxide and temperatures are responsible for weather fluctuations and global warming.

Weather fluctuation means untolerated heat and lack of precipitation or rain. Weather fluctuations will affect seasons. Seasons are necessary for maintaining the life cycle of organisms. Inappropriate seasons due to climatic change will affect the life of living organisms.

Global warming is an issue which is mainly due to release of hot heat trapping  gases from green house and other sources, increasing the atmospheric temperature. This will result in melting of ice from glaciers in world. The inhabiting animals living in the glaciers will suffer a lot from this as they cannot tolerate warm climatic conditions.

5 0
3 years ago
Read 2 more answers
Unlike a eukaryotic cell, a prokaryotic cell does not have
allsm [11]
C. The nucleus does not exit within a prokaryotic cell
5 0
3 years ago
Which of the following statements is(are) TRUE of pulmonary edema? I. Pulmonary edema may reduce lung compliance II. Pulmonary e
Colt1911 [192]

Answer:

II. Pulmonary edema occurs when interstitial fluid accumulates in tissues of the lung

Explanation:

Pulmonary edema is a condition that occurs when excess  of fluid filled in the numerous air sacs in the lungs, making it difficult to breathe.

Symptoms of pulmonary edema include wheezing, extreme shortness of breath, Cold, clammy skin, feeling of suffocating or drowning , Anxiety,  and restlessness or a sense of apprehension.

Treatment for pulmonary edema depends on the cause and generally include supplemental oxygen and medications.

Hence, the correct option is II. Pulmonary edema occurs when interstitial fluid accumulates in tissues of the lung.

3 0
3 years ago
Read 2 more answers
How many years does a nurse practitioner go to school?
Zepler [3.9K]
On sooory I send u answer in msg
3 0
3 years ago
Read 2 more answers
Other questions:
  • Can someone help me ??
    12·1 answer
  • The process by which an organism learns to produce a specific response in order to avoid or obtain an outcome is:
    11·1 answer
  • Describe how photosynthesis provides food for ecosystems?
    12·1 answer
  • Describe how a light microscope creates a magnified image
    8·1 answer
  • A part of the cytoskeleton of a cell, formed in prophase (in mitosis) or in prophase i (in meiosis), from which extend fibers th
    13·1 answer
  • Chris is studying oxidation and reduction reactions. Which of the following could she use as an example of an oxidation reaction
    13·1 answer
  • How many more oxygen atoms are represented in the formula for barium sulfate than in the formula for barium hydroxide?
    10·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Submit your air quality report for your area, showing seven days, the air quality color for each day, and each day's major
    6·1 answer
  • Define the term GOD cell.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!