Asexual reproduction is the when only one parent contributes genetic information creating an identical offspring. true Or false?

Biology

1 answer:

Nat2105 [25]2 years ago

7 0

Answer:

That is a true statement

You might be interested in

Where does cellular respiration occur in the human body? I.e., what part of the body

Ahat [919]

Answer: cellular report occurs in the respiratory system or the lungs and nasal cavity

explanation: it happens because when we intake oxygen, it reacts with glucose present in our body. this reaction gives out carbon dioxide, water and energy as products.

:))

7 0

3 years ago

The key ingredient of an arterial fluid classified as a cosmetic fluid is a(an)?

lesya692 [45]

I believe it’s an active dye?

4 0

2 years ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

2 years ago

Mendel observed that pairs of alleles were separated or segregated in gametes and that they were rejoined in fertilization. we k

alexira [117]

Homologous chromosomes....meiosis

3 0

2 years ago

Bacteria are often helpful because they

Alexus [3.1K]

Answer:

Yes it is helpful

Explanation:

Not only do we live in harmony with these beneficial bacteria, but they are actually essential to our survival. Good bacteria help our bodies digest food and absorb nutrients, and they produce several vitamins in the intestinal tract — including folic acid, niacin, and vitamins B6 and B12.

3 0

2 years ago