1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Irina-Kira [14]
3 years ago
9

The nurse is caring for a patient admitted to the psychiatric unit with a diagnosis of schizophrenia. the patient has not bathed

recently, and a family member states that the patient has not been out of the house for 10 days. on admission, the patient tells the nurse, "they are trying to hurt me; don't let them hurt me." this is an example of which symptom?
Biology
1 answer:
seropon [69]3 years ago
5 0

<span>This is an example of persecutory hallucinations in</span> which the affected persons believe they are being maliciously maligned, persecuted, obstructed, trick, spied on or physically hurt. Persecutory hallucinations or delusions are the most common form of delusions in <span>paranoid schizophrenia. Generally, the patient thinks that harm is occurring, or is going to occur. Individuals with this kind of hallucinations are often resentful and angry, leading to an act of violence against those they believe are hurting them or their loved one.</span>

You might be interested in
if a virus enters my body will it enter and leave alone or will it enter and infect cells please i need help
pishuonlain [190]

Answer:

Virus are a type of infectious agents it in almost all scenarios it will infect as many as cells it can before your WBC's can kill them

And in fact you are right now only in the state of Disease free. Every second your body is fighting off diseases. So to support your immune system eat Lots of Healthy food and stay safe!

4 0
3 years ago
Read 2 more answers
The simple interest on a loans of $200 at 10 percent interest per year is
inysia [295]
<h2>Simple Interest on a Loans - Option C</h2>

The simple interest on loans of $200 at 10 percent interest per year is $20 per year until the loan is paid off. Interest per year means the expense of interest that is charged for annum as a percentage of the value which is hired.

In order to calculate interest per year, multiply the principal basis for the rent by the interest per year then divide the value of interest per year by 12 (number of months in a year). Therefore, for simple interest on loans of 200 dollars at 10 percent interest per year, we calculate 20 dollars per year until the loan is paid off.


6 0
3 years ago
Read 2 more answers
Autoimmunities are relatively uncommon. What usually happens to autoimmune antibody-producing clones during development
vesna_86 [32]

Answer

There is not enough antibody-producing clones during development therefore the immune system suffers.

6 0
3 years ago
Most fertilizers contain ammonia. Ammonia (NH3) forms when hydrogen reacts with nitrogen. Which balanced equation represents amm
Inessa05 [86]
N2(g) + 3H2(g) <--> 2NH3(g) 
Bear in mind that this is a reversible reaction. 
5 0
3 years ago
Read 2 more answers
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
Other questions:
  • Maria lost her job because the economy is shrinking. This is an example of
    12·2 answers
  • A microbiologist observed the genetic sequence of DNA change from
    15·1 answer
  • The two sides of the DNA ladder are connected down the middle by many _______ bonds. *
    13·2 answers
  • The wings of the housefly and the bat are_________?
    12·2 answers
  • Increasing the volume of air that reaches the alveoli and takes part in gas exchange will cause blood pH to:
    10·1 answer
  • What biological macromolecule is made up of monomers like the one shown below?
    12·1 answer
  • Are birds more closely related to mammals or to reptiles
    12·2 answers
  • Which units represent density? Select all that apply.
    12·2 answers
  • C.<br>UE341<br>b. frog<br>37.Ophiology is the study of<br>a. Lizard<br>c. snake<br>d. fish​
    14·1 answer
  • What would happen to the population of wolves if the deer began to emigrate from the tundra?
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!