1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
netineya [11]
3 years ago
12

Darwin’s observations of finches indicated descent with

Biology
1 answer:
RSB [31]3 years ago
5 0
Darwin’s observations of finches indicated descent with Modification in bills.<span>
They had become adapted to eating different diets, </span>Beak shape of finches is affected by the type of food available to eat. Finches<span> are generally seedeaters and eat a variety of plant seeds. There are times though that their diet will be composed of insects and certain fruits, berries and vegetation.</span>
You might be interested in
HELP ME NOOOOOOOOOOW ILL GIVE BRAINLIEST
MrRissso [65]

Answer:

D.

Explanation:

The first two options, A and B, can be eliminated because we know that the growth rate must be negative — more people are dying than are being born!

The term "per capita" means per person. Which answer makes more sense, losing 1.2 people per person or 0.12 people per person? While both might be a little confusing, you can't lose more than one person per person! Therefore, the answer is D.

7 0
3 years ago
What is penicillin used for?
rjkz [21]
I i used to treat infections caused by bacteria. And also ear, skin ad throat infections

5 0
3 years ago
John overheard his brother say that Earth is able to support life because it is the only planet with an atmosphere. Do you think
Dafna11 [192]
I think this is False since I think earth can hold life since there’s gravity and many sources of food and water to have as well as shelter. Also there’s oxygen so we can breathe. And god brought us her. So yeha ‍♀️
6 0
3 years ago
What is the source, target, and action of erythropoietin
larisa [96]
Kidneys, Bone Marrow, and it Produces red blood cells.
6 0
3 years ago
How do chemical stains make light microscopes more useful
anastassius [24]
When a specimen is to be observed under the light microscope, scientists usually stain the specimens using different type of chemical stains depending on the type of specimen to be observed. Staining of specimen make the structures that are to be observed in the specimen very visible under the microscope, this make it easy for scientists to observe their structures.
8 0
3 years ago
Other questions:
  • Sort the descriptions into the appropriate bins, which illustrate the types of biaxial movement.
    13·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • The ultimate purpose of the digestive system is to:
    6·1 answer
  • How does crossing over contribute to genetic diversity​
    5·1 answer
  • Which side of a leaf transpires the most?
    10·1 answer
  • How does the immune system work together with the circulatory system to function properly?
    6·1 answer
  • Nterruption of blood supply to the brain caused by cerebral thrombosis, cerebral embolus, or cerebral hemorrhage is
    10·2 answers
  • How does the bone protect the immune system?<br><br> please help
    11·1 answer
  • In the synthesis phase (s phase) of the cell cycle, a body cell copies it's DNA. This DNA replication occurs in preperation for
    12·2 answers
  • The human circulatory system
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!