1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
anyanavicka [17]
3 years ago
5

Which statement correctly compares the roles of different types of organic molecules in the body?

Biology
1 answer:
Vinvika [58]3 years ago
5 0

Answer:A

Explanation:

You might be interested in
Match the following glands.
tatyana61 [14]

Answer:

1 . base of brain : A. pituitary

2 . located on kidneys : C. adrenal

3 . located in the neck : D. thyroid

4 . associated with the small intestine : B. pancreas

Explanation:

Hypothalamus is present below the thalamus of the brain. The pituitary gland is present at the base of the brain in the hypophyseal fossa. Adrenal glands are the paired glands. One adrenal gland lies superior to each kidney in the retroperitoneal space.

The thyroid gland is a butterfly-shaped gland and is located just inferior to the larynx in the neck. The right and left lateral lobes of this gland are present on either side of the trachea. The pancreas is usually connected to the duodenum of the small intestine by two ducts. This arrangement releases the pancreatic juice into the small intestine.

8 0
3 years ago
A clock that sets five minutes fast is less than an identical clock that keeps correct time
Dafna1 [17]

Answer:

false!

Explanation:

7 0
4 years ago
A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
AnnyKZ [126]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

3 0
3 years ago
How have humans caused damage and change to each of the earths spheres
vampirchik [111]
Humans caused damaged by all the pollution in the earth atmosphere with is making global warming it changes by how much pullution is going into the atmosphere
3 0
3 years ago
Mutagens are useful in biotechnology research for producing organisms with altered phenotypes. producing new organisms which hav
ICE Princess25 [194]

Answer:

The correct answer is A.

Explanation:

A mutagen changes the level of mutations that occur in the DNA either by affecting it physically or chemically. This helps researchers create different organisms with altered phenotypes according to what the research needs so that the genes can be investigated further under a controlled environment.

So the answer is A.

I hope this helps.

4 0
4 years ago
Other questions:
  • Each alveolus is surrounded by a web of blood capillaries supplied by the _________.
    7·1 answer
  • Animals that possess homologous structures probably _____.
    14·1 answer
  • What are the name of the structures seen in the chloroplast to the right?
    15·1 answer
  • Under what circumstances does membrane transport always require energy?
    10·1 answer
  • Please help me with the questions
    10·1 answer
  • Horticulture has a large support system to agriculture.This is known as the ?
    12·1 answer
  • A fellow student in the class is looking at a slide of onion root tip cells and is excited that he can see the chromosomes under
    9·2 answers
  • Which row in the chart below contains correct information concerning synthesis??
    8·1 answer
  • Building a mass transit system is likely to have which of the following effects?
    10·2 answers
  • What’s the answer???
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!