Answer:
The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.
Explanation:
Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.
If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:
<u>Exercise 1:</u>
- DNA ATACGAAATCGCGATCGCGGCGATTCGG
- mRNA UAUGCUUUAGCGCUAGCGCCGCUAAGCC
- CODON UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
- AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
- Amino acid Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser
<u>Exercise 2: </u>
- DNA TTTACGGCCATCAGGCAATACTGG
- mRNA AAAUGCCGGUAGUCCGUUAUGACC
- CODON AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
- AntiCODON UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
- Amino acid Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
According to the repost made by US Surgeon General
released in 2014, a total of 7,787,000 people died from smoking induced
cardiovascular disease from 1965 to 2014. Cigarette smoking and second-hand
tobacco smoke has been causally linked to cardiovascular diseases.
The Answer are :
Nervous Tissue
Immune System
Again, Immune System
Antibody
Antibodies
Vitamins
Vitamin C
osteomalacia
Chyme
glomerulus
Explanation:
Nervous tissue is one of four major classes of tissues. It is specialized tissue found in the central nervous system and the peripheral nervous system. It consists of neurons and supporting cells called neuroglia. The nervous system is responsible for the control of the body and the communication among its parts.
The immune system protects your child's body from outside invaders, such as bacteria, viruses, fungi, and toxins (chemicals produced by microbes). It is made up of different organs, cells, and The immune system protects the body from worms, germs, and other agents of harm. The immune system is like a medieval castle. ... The body's first line of defense consists of different types of barriers that keep most pathogens out of the body. Pathogens are disease-causing agents, such as bacteria and viruses. proteins that work together.
Honey has been linked to health benefits like improved heart health, wound healing, and blood antioxidant status. However, consuming too much may cause adverse effects due to its high sugar and calorie content. Thus, it's best to use honey to replace other forms of sugar and enjoy it in moderation.
Antibodies are proteins that recognize and bind parts of viruses to neutralize them. Antibodies are produced by our white blood cells and are a major part of the body's response to combating a viral infection. Antigens are substances that cause the body to produce antibodies, such as a viral protein.
Vitamins are substances that your body needs to grow and develop normally. There are 13 vitamins your body needs. They are. Vitamin A. B vitamins (thiamine, riboflavin, niacin, pantothenic acid, biotin, vitamin B-6, vitamin B-12 and folate)
a disease caused by a deficiency of vitamin C, characterized by swollen bleeding gums and the opening of previously healed wounds, which particularly affected poorly nourished sailors until the end of the 18th century.
osteomalacia
Rickets is a rare disease that causes the bones to become soft and bend. African American infants and children are at higher risk of getting rickets. In adults, severe vitamin D deficiency leads to osteomalacia. Osteomalacia causes weak bones, bone pain, and muscle weakness.
Chyme or chymus is the semi-fluid mass of partly digested food that is expelled by the stomach, through the pyloric valve, into the duodenum. Chyme results from the mechanical and chemical breakdown of a bolus and consists of partially digested food, water, hydrochloric acid, and various digestive enzymes.
The first step in making urine is to separate the liquid part of your blood (plasma), which contains all the dissolved solutes, from your blood cells. Each nephron in your kidneys has a microscopic filter, called a glomerulus that is constantly filtering your blood.
Answer:
The molecule on the right; the middle carbon is asymmetric
Explanation:
