Gets smaller
Please mark as brainliest!
The answer is highlighted in bold: <span>ttttagccatttacgattaatcg.
This DNA template</span> is <span>written 5' to 3', just like it's supposed to be. The complementary strand also needs to be that way.
</span>
<span>5' ttttagccatttacgattaatcg 3' </span><span>the direction (--->)
3' ..</span>aatcg........................ 5' the direction (<---)
adenine (A) will bind with thymine (T) and guanine (G) will bond with cytosine (C).
Answer:
What are some of the types of human carbon emissions?
Carbon sources include the combustion of fossil fuels (coal, natural gas, and oil) by humans for energy and transportation and farmland (by animal respiration), although there are proposals for improvements in farming practices to reverse this.
Explanation:
The more energy needed, the higher the melting point or boiling point . As metals are giant lattice structures, the number of electrostatic forces to be broken is extremely large, and so metals have high melting and boiling points.
i would go with true.
