Aristotle classification
He classified plant and animals into two separate kingdoms
Modern Classification
In this system also, there were two separate kingdoms for plant and animals
The two main components of the extracellular matrix are Elastin and Collagen.
The extracellular matrix is an intricate macromolecular network that is found in the extracellular space. The matrix is composed of polysaccharides and very diverse proteins, locally secreted and assembled forming a complex network that surrounds the cells. The matrix is highly developed in connective tissue and its derivatives. The extracellular matrix is formed mainly by proteins, glycosaminoglycans,proteoglycans and glycoproteins, organized in diverse networks that constitute the different tissues. <em>The most abundant proteins are collagen and elastin.</em>
Collagen is a family of very abundant proteins in the body of animals. Collagen molecules can represent 25 to 30 % of all body proteins. Its main mission in the tissues is to form a framework that supports the tissues and that resists the forces of mechanical tension.
The elastin molecules are very close to each other through links between the regions rich in the amino acid lysine. It is an abundant protein in may extracellular matrices and appears as a component of the so called elastic fibers, which are onsoluble aggregates of proteins.
Answer:
Charles Darwin
Explanation:
Natural selection, most famously proposed by Charles Darwin, states that when presented with an environmental challenge, some individuals in a species will develop adaptations to face these challenges. Successful individuals will be more likely to mate and their offspring will inherit these adaptive traits, and will continue to pass for generations.
In this sense, plants face the challenge of the cold. Those that adapt to the cold will survive and reproduce, those that can't adapt to the cold will die. Eventually, only plants that can tolerate the cold will survive.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:The answer is Desert
Explanation:The dead giveaway is thick skin to prevent water loss and burrow to escape the heat.
