1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
katovenus [111]
2 years ago
5

What two things must come together to form a seed?

Biology
1 answer:
Dmitry [639]2 years ago
7 0

Answer:

Double fertilization involves two sperm cells; one fertilizes the egg cell to form the zygote, while the other fuses with the two polar nuclei that form the endosperm. After fertilization, the fertilized ovule forms the seed while the tissues of the ovary become the fruit.

You might be interested in
One of the first breakthroughs in biotechnology was the discovery of the gene that makes insulin. What was the first step of thi
Elis [28]

the answer is a took the test

5 0
3 years ago
Read 2 more answers
Among human population, most fresh is used for
Masteriza [31]
The answer would be water.
6 0
2 years ago
What part of the nervous system do the nerves in your skin belong to?
Margarita [4]
There are two sets of nerves in your skin. The first type are somatosensory neurons that send sensory information to your central nervous syste. The second set consists of autonomic fibers that control smooth muscle in the skin and the blood vessels in the skin.
5 0
2 years ago
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
2 years ago
Why are shell of marine snails heavier than garden snails?
const2013 [10]
They have to have a higher density than water to have the ability to stay on the sea floor. Otherwise they would just float to the surface of the water
6 0
3 years ago
Other questions:
  • Which of the following is not a benefit of agar as a solid medium?
    10·1 answer
  • How can a natural event such as a volcanic eruption affect biodiversity? Erupting volcanoes emit gases such as sulfur dioxide in
    14·2 answers
  • The life expectancy at birth in sierra leone is about 38 years. what can you infer about the population of sierra leone?
    9·1 answer
  • A client is admitted to the coronary care unit with atrial fibrillation and a rapid ventricular response. the nurse prepares for
    11·1 answer
  • Man made chemicals have decreased the amount of which important gas?
    14·1 answer
  • Which is not a type of passive transport?
    15·1 answer
  • 1. Identify what type of rock belongs in #2
    14·1 answer
  • Water molecules are _____ due to _____ bonding
    15·1 answer
  • Tanya is training a turtle for a turtle race. For every 1/6 of an hour that the turtle is crawling he can travel 1/24 of a mile.
    11·1 answer
  • Explain the primary differences between artificial and natural selection.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!